Incidental Mutation 'R5504:Pear1'
ID430813
Institutional Source Beutler Lab
Gene Symbol Pear1
Ensembl Gene ENSMUSG00000028073
Gene Nameplatelet endothelial aggregation receptor 1
SynonymsJedi-1, 3110045G13Rik
MMRRC Submission 043065-MU
Accession Numbers

Ncbi RefSeq: NM_001032413.1, NM_001032414.1, NM_028460.2, NM_152799.2; MGI:1920432

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5504 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location87747890-87824306 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 87752695 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023846] [ENSMUST00000029714] [ENSMUST00000079083] [ENSMUST00000090981] [ENSMUST00000172621] [ENSMUST00000173468] [ENSMUST00000174219] [ENSMUST00000174267] [ENSMUST00000174713] [ENSMUST00000174759]
Predicted Effect probably benign
Transcript: ENSMUST00000023846
SMART Domains Protein: ENSMUSP00000023846
Gene: ENSMUSG00000023084

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Blast:LRR 165 191 6e-7 BLAST
LRR 219 246 4.24e-1 SMART
LRR 251 278 1.33e-1 SMART
LRR 279 306 1.98e-4 SMART
low complexity region 312 323 N/A INTRINSIC
low complexity region 329 337 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
low complexity region 407 414 N/A INTRINSIC
LRR 472 499 1.83e2 SMART
low complexity region 547 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000029714
SMART Domains Protein: ENSMUSP00000029714
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079083
SMART Domains Protein: ENSMUSP00000078090
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090981
SMART Domains Protein: ENSMUSP00000088503
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172621
SMART Domains Protein: ENSMUSP00000133474
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172631
Predicted Effect probably benign
Transcript: ENSMUST00000172669
SMART Domains Protein: ENSMUSP00000134451
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
EGF_like 1 34 1.85e0 SMART
EGF 33 65 3.1e-2 SMART
EGF 76 108 2.53e1 SMART
transmembrane domain 128 150 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173468
SMART Domains Protein: ENSMUSP00000133988
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:EMI 23 96 2.1e-16 PFAM
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF 184 215 1.84e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174208
Predicted Effect probably benign
Transcript: ENSMUST00000174219
SMART Domains Protein: ENSMUSP00000133565
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
EGF 15 47 4.03e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174267
SMART Domains Protein: ENSMUSP00000133626
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174381
Predicted Effect probably benign
Transcript: ENSMUST00000174713
SMART Domains Protein: ENSMUSP00000134215
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174759
SMART Domains Protein: ENSMUSP00000133323
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.6%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PEAR1 is a platelet receptor that signals upon the formation of platelet-platelet contacts independent of platelet activation and secondary to platelet aggregation (Nanda et al., 2005 [PubMed 15851471]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show no apparent defects in hemostasis or thrombus formation. Although in vitro dextran sulfate-induced platelet aggregation is impaired, platelet aggregation initiated with physiological agonists is normal. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1b7 A G 6: 34,419,518 probably null Het
Amy2a1 T G 3: 113,531,669 D92A probably benign Het
Angel2 A G 1: 190,943,886 T455A probably damaging Het
Angptl2 T C 2: 33,229,038 probably benign Het
Ankrd40 A G 11: 94,328,327 E25G probably benign Het
Asb18 T A 1: 89,993,024 D136V probably damaging Het
Asphd1 T C 7: 126,946,178 I336V possibly damaging Het
Birc6 C T 17: 74,655,213 P58S probably damaging Het
Bsx A T 9: 40,874,164 probably benign Het
Cabin1 A G 10: 75,653,009 L1965P probably benign Het
Capza3 A T 6: 140,042,439 I255L probably benign Het
Ccdc185 G T 1: 182,747,627 A499E probably damaging Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Colgalt2 G A 1: 152,400,303 V56M possibly damaging Het
Dennd1b A T 1: 139,090,508 T197S probably benign Het
Dhx30 A G 9: 110,085,210 Y1000H probably benign Het
Dlg2 C T 7: 92,442,657 A910V probably damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dock5 T C 14: 67,803,086 D884G probably benign Het
Fhad1 A G 4: 141,985,535 S198P probably benign Het
Gabpa T C 16: 84,852,558 S218P probably benign Het
Gm17654 A T 14: 43,578,037 N104K unknown Het
Gm1966 T A 7: 106,602,744 noncoding transcript Het
Gm4775 T C 14: 106,100,955 noncoding transcript Het
Gm4788 A T 1: 139,701,820 S749T probably benign Het
Gm5346 C T 8: 43,625,282 C635Y probably damaging Het
Heatr1 T A 13: 12,406,619 S467T possibly damaging Het
Hecw1 A G 13: 14,340,902 M215T probably benign Het
Hmgn2 A T 4: 133,966,803 probably benign Het
Kncn T A 4: 115,884,865 I43N possibly damaging Het
Lgals3bp G T 11: 118,393,985 T256N probably benign Het
Mpi T C 9: 57,545,217 D344G probably damaging Het
Myom2 G A 8: 15,128,879 E1304K probably damaging Het
Npat T A 9: 53,570,264 F1091I probably benign Het
Nrcam T G 12: 44,564,132 probably null Het
Olfr1219 C T 2: 89,074,680 R137Q probably benign Het
Olfr13 T A 6: 43,174,638 Y217* probably null Het
Olfr684 T C 7: 105,157,176 K169E probably benign Het
Pappa2 A G 1: 158,848,045 S1044P probably benign Het
Pcnx4 T C 12: 72,574,448 L1014S probably damaging Het
Piwil2 T A 14: 70,389,899 Y797F probably benign Het
Ppp2r1b T G 9: 50,858,887 L81R probably damaging Het
Pxdn C A 12: 30,002,801 H812Q probably damaging Het
Rad21l A T 2: 151,668,437 F33I probably damaging Het
Rgs13 A T 1: 144,139,620 C120S possibly damaging Het
Rp1 G A 1: 4,349,890 T333M probably damaging Het
Sema6d T A 2: 124,658,021 V339E probably damaging Het
Serpina3i T A 12: 104,266,603 Y256N probably damaging Het
Slc13a1 A T 6: 24,150,744 M65K possibly damaging Het
Slco6d1 A G 1: 98,421,339 K45R probably damaging Het
Src T C 2: 157,464,721 Y215H probably damaging Het
Synj2 T C 17: 6,036,475 V384A possibly damaging Het
Tmeff1 T C 4: 48,650,396 S285P probably damaging Het
Vmn2r125 A G 4: 156,351,161 D278G possibly damaging Het
Vmn2r45 T C 7: 8,483,177 K371E probably benign Het
Zfp866 A T 8: 69,765,691 H426Q probably benign Het
Other mutations in Pear1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Pear1 APN 3 87752116 missense possibly damaging 0.65
IGL01810:Pear1 APN 3 87752301 missense probably damaging 0.98
IGL02269:Pear1 APN 3 87756264 missense probably damaging 1.00
IGL02635:Pear1 APN 3 87750146 makesense probably null
R0040:Pear1 UTSW 3 87754358 missense probably damaging 0.99
R0040:Pear1 UTSW 3 87754358 missense probably damaging 0.99
R0050:Pear1 UTSW 3 87755987 nonsense probably null
R0050:Pear1 UTSW 3 87755987 nonsense probably null
R0090:Pear1 UTSW 3 87754342 missense possibly damaging 0.82
R0547:Pear1 UTSW 3 87788800 intron probably null
R1024:Pear1 UTSW 3 87760299 unclassified probably benign
R1612:Pear1 UTSW 3 87751853 critical splice donor site probably null
R1637:Pear1 UTSW 3 87756753 missense probably damaging 0.97
R1772:Pear1 UTSW 3 87754492 unclassified probably benign
R1888:Pear1 UTSW 3 87810575 splice site probably benign
R2129:Pear1 UTSW 3 87758359 nonsense probably null
R2255:Pear1 UTSW 3 87752186 missense probably damaging 1.00
R3551:Pear1 UTSW 3 87758132 missense probably benign
R3855:Pear1 UTSW 3 87751921 missense possibly damaging 0.94
R4021:Pear1 UTSW 3 87756222 missense possibly damaging 0.89
R4546:Pear1 UTSW 3 87754661 missense probably damaging 1.00
R5364:Pear1 UTSW 3 87758361 missense probably damaging 1.00
R5447:Pear1 UTSW 3 87759142 missense probably damaging 1.00
R6026:Pear1 UTSW 3 87756913 missense probably damaging 1.00
R6061:Pear1 UTSW 3 87755931 missense probably benign 0.02
R6155:Pear1 UTSW 3 87759568 missense probably damaging 0.97
R6175:Pear1 UTSW 3 87752133 missense possibly damaging 0.93
R6339:Pear1 UTSW 3 87752520 missense probably damaging 1.00
R6385:Pear1 UTSW 3 87754199 missense probably benign 0.00
R6715:Pear1 UTSW 3 87759117 missense probably damaging 1.00
R6929:Pear1 UTSW 3 87759565 nonsense probably null
R7088:Pear1 UTSW 3 87754638 missense possibly damaging 0.80
R7097:Pear1 UTSW 3 87751445 missense probably benign 0.00
R7229:Pear1 UTSW 3 87750289 missense probably benign 0.00
R7334:Pear1 UTSW 3 87750225 missense probably damaging 1.00
R7526:Pear1 UTSW 3 87752568 missense probably damaging 0.99
X0063:Pear1 UTSW 3 87754072 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACTCACCCATTTTGCAGTC -3'
(R):5'- ATACTGAGGGAATGGCCAGGTC -3'

Sequencing Primer
(F):5'- GCAGTCTGCACCACTGTGTC -3'
(R):5'- AATGGCCAGGTCTTGCC -3'
Posted On2016-10-05