Incidental Mutation 'R5504:Gm1966'
ID430827
Institutional Source Beutler Lab
Gene Symbol Gm1966
Ensembl Gene ENSMUSG00000073902
Gene Namepredicted gene 1966
Synonyms
MMRRC Submission 043065-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R5504 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location106596743-106604035 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) T to A at 106602744 bp
ZygosityHeterozygous
Amino Acid Change
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184540
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.6%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1b7 A G 6: 34,419,518 probably null Het
Amy2a1 T G 3: 113,531,669 D92A probably benign Het
Angel2 A G 1: 190,943,886 T455A probably damaging Het
Angptl2 T C 2: 33,229,038 probably benign Het
Ankrd40 A G 11: 94,328,327 E25G probably benign Het
Asb18 T A 1: 89,993,024 D136V probably damaging Het
Asphd1 T C 7: 126,946,178 I336V possibly damaging Het
Birc6 C T 17: 74,655,213 P58S probably damaging Het
Bsx A T 9: 40,874,164 probably benign Het
Cabin1 A G 10: 75,653,009 L1965P probably benign Het
Capza3 A T 6: 140,042,439 I255L probably benign Het
Ccdc185 G T 1: 182,747,627 A499E probably damaging Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Colgalt2 G A 1: 152,400,303 V56M possibly damaging Het
Dennd1b A T 1: 139,090,508 T197S probably benign Het
Dhx30 A G 9: 110,085,210 Y1000H probably benign Het
Dlg2 C T 7: 92,442,657 A910V probably damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dock5 T C 14: 67,803,086 D884G probably benign Het
Fhad1 A G 4: 141,985,535 S198P probably benign Het
Gabpa T C 16: 84,852,558 S218P probably benign Het
Gm17654 A T 14: 43,578,037 N104K unknown Het
Gm4775 T C 14: 106,100,955 noncoding transcript Het
Gm4788 A T 1: 139,701,820 S749T probably benign Het
Gm5346 C T 8: 43,625,282 C635Y probably damaging Het
Heatr1 T A 13: 12,406,619 S467T possibly damaging Het
Hecw1 A G 13: 14,340,902 M215T probably benign Het
Hmgn2 A T 4: 133,966,803 probably benign Het
Kncn T A 4: 115,884,865 I43N possibly damaging Het
Lgals3bp G T 11: 118,393,985 T256N probably benign Het
Mpi T C 9: 57,545,217 D344G probably damaging Het
Myom2 G A 8: 15,128,879 E1304K probably damaging Het
Npat T A 9: 53,570,264 F1091I probably benign Het
Nrcam T G 12: 44,564,132 probably null Het
Olfr1219 C T 2: 89,074,680 R137Q probably benign Het
Olfr13 T A 6: 43,174,638 Y217* probably null Het
Olfr684 T C 7: 105,157,176 K169E probably benign Het
Pappa2 A G 1: 158,848,045 S1044P probably benign Het
Pcnx4 T C 12: 72,574,448 L1014S probably damaging Het
Pear1 G A 3: 87,752,695 probably benign Het
Piwil2 T A 14: 70,389,899 Y797F probably benign Het
Ppp2r1b T G 9: 50,858,887 L81R probably damaging Het
Pxdn C A 12: 30,002,801 H812Q probably damaging Het
Rad21l A T 2: 151,668,437 F33I probably damaging Het
Rgs13 A T 1: 144,139,620 C120S possibly damaging Het
Rp1 G A 1: 4,349,890 T333M probably damaging Het
Sema6d T A 2: 124,658,021 V339E probably damaging Het
Serpina3i T A 12: 104,266,603 Y256N probably damaging Het
Slc13a1 A T 6: 24,150,744 M65K possibly damaging Het
Slco6d1 A G 1: 98,421,339 K45R probably damaging Het
Src T C 2: 157,464,721 Y215H probably damaging Het
Synj2 T C 17: 6,036,475 V384A possibly damaging Het
Tmeff1 T C 4: 48,650,396 S285P probably damaging Het
Vmn2r125 A G 4: 156,351,161 D278G possibly damaging Het
Vmn2r45 T C 7: 8,483,177 K371E probably benign Het
Zfp866 A T 8: 69,765,691 H426Q probably benign Het
Other mutations in Gm1966
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01400:Gm1966 APN 7 106602035 missense probably benign 0.10
IGL01410:Gm1966 APN 7 106603051 exon noncoding transcript
IGL01415:Gm1966 APN 7 106603051 exon noncoding transcript
IGL01538:Gm1966 APN 7 106602537 missense probably damaging 0.96
IGL01751:Gm1966 APN 7 106602309 missense possibly damaging 0.80
IGL01916:Gm1966 APN 7 106601826 missense probably benign 0.28
IGL02171:Gm1966 APN 7 106601341 exon noncoding transcript
IGL02550:Gm1966 APN 7 106601639 exon noncoding transcript
H8562:Gm1966 UTSW 7 106603149 missense probably damaging 1.00
R0016:Gm1966 UTSW 7 106603246 missense probably benign 0.00
R0178:Gm1966 UTSW 7 106601821 missense probably damaging 1.00
R0420:Gm1966 UTSW 7 106603883 missense probably damaging 1.00
R0658:Gm1966 UTSW 7 106602886 missense possibly damaging 0.89
R1378:Gm1966 UTSW 7 106602166 missense probably damaging 0.97
R1506:Gm1966 UTSW 7 106601581 missense probably benign 0.08
R1628:Gm1966 UTSW 7 106603269 nonsense probably null
R1834:Gm1966 UTSW 7 106603776 missense possibly damaging 0.79
R1888:Gm1966 UTSW 7 106597423 exon noncoding transcript
R2145:Gm1966 UTSW 7 106603008 missense possibly damaging 0.84
R4056:Gm1966 UTSW 7 106604009 missense possibly damaging 0.59
R4067:Gm1966 UTSW 7 106599565 exon noncoding transcript
R4631:Gm1966 UTSW 7 106599523 exon noncoding transcript
R4817:Gm1966 UTSW 7 106601230 exon noncoding transcript
R4900:Gm1966 UTSW 7 106598586 exon noncoding transcript
R4970:Gm1966 UTSW 7 106600657 exon noncoding transcript
R5009:Gm1966 UTSW 7 106601560 exon noncoding transcript
R5050:Gm1966 UTSW 7 106596972 exon noncoding transcript
R5086:Gm1966 UTSW 7 106598027 exon noncoding transcript
R5090:Gm1966 UTSW 7 106600902 exon noncoding transcript
R5168:Gm1966 UTSW 7 106596847 exon noncoding transcript
R5260:Gm1966 UTSW 7 106599204 exon noncoding transcript
R5331:Gm1966 UTSW 7 106598751 exon noncoding transcript
R5389:Gm1966 UTSW 7 106598235 exon noncoding transcript
R5433:Gm1966 UTSW 7 106600107 exon noncoding transcript
R5488:Gm1966 UTSW 7 106601590 exon noncoding transcript
R5489:Gm1966 UTSW 7 106601590 exon noncoding transcript
R5956:Gm1966 UTSW 7 106601470 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- CAGTTCTGTGACTGGACAGG -3'
(R):5'- TCTCATGCTAACCAAGGCCC -3'

Sequencing Primer
(F):5'- CAGTTCTGTGACTGGACAGGATAATG -3'
(R):5'- CTGCTGGAAAGCCATTTCAG -3'
Posted On2016-10-05