Incidental Mutation 'R5504:Heatr1'
ID430845
Institutional Source Beutler Lab
Gene Symbol Heatr1
Ensembl Gene ENSMUSG00000050244
Gene NameHEAT repeat containing 1
SynonymsB130016L12Rik
MMRRC Submission 043065-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R5504 (G1)
Quality Score216
Status Validated
Chromosome13
Chromosomal Location12395027-12440289 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12406619 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 467 (S467T)
Ref Sequence ENSEMBL: ENSMUSP00000054084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059270] [ENSMUST00000221046]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059270
AA Change: S467T

PolyPhen 2 Score 0.644 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000054084
Gene: ENSMUSG00000050244
AA Change: S467T

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:U3snoRNP10 238 354 7e-30 PFAM
SCOP:d1qbkb_ 919 1795 3e-8 SMART
low complexity region 1805 1814 N/A INTRINSIC
BP28CT 1856 2009 2.25e-77 SMART
Blast:BP28CT 2015 2061 2e-15 BLAST
coiled coil region 2109 2137 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221046
Meta Mutation Damage Score 0.0715 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.6%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1b7 A G 6: 34,419,518 probably null Het
Amy2a1 T G 3: 113,531,669 D92A probably benign Het
Angel2 A G 1: 190,943,886 T455A probably damaging Het
Angptl2 T C 2: 33,229,038 probably benign Het
Ankrd40 A G 11: 94,328,327 E25G probably benign Het
Asb18 T A 1: 89,993,024 D136V probably damaging Het
Asphd1 T C 7: 126,946,178 I336V possibly damaging Het
Birc6 C T 17: 74,655,213 P58S probably damaging Het
Bsx A T 9: 40,874,164 probably benign Het
Cabin1 A G 10: 75,653,009 L1965P probably benign Het
Capza3 A T 6: 140,042,439 I255L probably benign Het
Ccdc185 G T 1: 182,747,627 A499E probably damaging Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Colgalt2 G A 1: 152,400,303 V56M possibly damaging Het
Dennd1b A T 1: 139,090,508 T197S probably benign Het
Dhx30 A G 9: 110,085,210 Y1000H probably benign Het
Dlg2 C T 7: 92,442,657 A910V probably damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dock5 T C 14: 67,803,086 D884G probably benign Het
Fhad1 A G 4: 141,985,535 S198P probably benign Het
Gabpa T C 16: 84,852,558 S218P probably benign Het
Gm17654 A T 14: 43,578,037 N104K unknown Het
Gm1966 T A 7: 106,602,744 noncoding transcript Het
Gm4775 T C 14: 106,100,955 noncoding transcript Het
Gm4788 A T 1: 139,701,820 S749T probably benign Het
Gm5346 C T 8: 43,625,282 C635Y probably damaging Het
Hecw1 A G 13: 14,340,902 M215T probably benign Het
Hmgn2 A T 4: 133,966,803 probably benign Het
Kncn T A 4: 115,884,865 I43N possibly damaging Het
Lgals3bp G T 11: 118,393,985 T256N probably benign Het
Mpi T C 9: 57,545,217 D344G probably damaging Het
Myom2 G A 8: 15,128,879 E1304K probably damaging Het
Npat T A 9: 53,570,264 F1091I probably benign Het
Nrcam T G 12: 44,564,132 probably null Het
Olfr1219 C T 2: 89,074,680 R137Q probably benign Het
Olfr13 T A 6: 43,174,638 Y217* probably null Het
Olfr684 T C 7: 105,157,176 K169E probably benign Het
Pappa2 A G 1: 158,848,045 S1044P probably benign Het
Pcnx4 T C 12: 72,574,448 L1014S probably damaging Het
Pear1 G A 3: 87,752,695 probably benign Het
Piwil2 T A 14: 70,389,899 Y797F probably benign Het
Ppp2r1b T G 9: 50,858,887 L81R probably damaging Het
Pxdn C A 12: 30,002,801 H812Q probably damaging Het
Rad21l A T 2: 151,668,437 F33I probably damaging Het
Rgs13 A T 1: 144,139,620 C120S possibly damaging Het
Rp1 G A 1: 4,349,890 T333M probably damaging Het
Sema6d T A 2: 124,658,021 V339E probably damaging Het
Serpina3i T A 12: 104,266,603 Y256N probably damaging Het
Slc13a1 A T 6: 24,150,744 M65K possibly damaging Het
Slco6d1 A G 1: 98,421,339 K45R probably damaging Het
Src T C 2: 157,464,721 Y215H probably damaging Het
Synj2 T C 17: 6,036,475 V384A possibly damaging Het
Tmeff1 T C 4: 48,650,396 S285P probably damaging Het
Vmn2r125 A G 4: 156,351,161 D278G possibly damaging Het
Vmn2r45 T C 7: 8,483,177 K371E probably benign Het
Zfp866 A T 8: 69,765,691 H426Q probably benign Het
Other mutations in Heatr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Heatr1 APN 13 12410450 missense probably benign 0.00
IGL00863:Heatr1 APN 13 12435128 missense probably benign 0.02
IGL00899:Heatr1 APN 13 12435176 missense probably benign 0.31
IGL01147:Heatr1 APN 13 12437912 missense probably damaging 0.99
IGL01317:Heatr1 APN 13 12399027 missense probably damaging 1.00
IGL01323:Heatr1 APN 13 12398938 missense possibly damaging 0.86
IGL01625:Heatr1 APN 13 12413528 missense probably damaging 0.98
IGL01973:Heatr1 APN 13 12429799 missense probably benign
IGL02803:Heatr1 APN 13 12433986 missense probably damaging 0.96
IGL02830:Heatr1 APN 13 12426212 missense possibly damaging 0.57
IGL02956:Heatr1 APN 13 12416059 missense possibly damaging 0.53
IGL03000:Heatr1 APN 13 12434411 missense probably damaging 0.99
IGL03024:Heatr1 APN 13 12407509 unclassified probably benign
IGL03035:Heatr1 APN 13 12413219 splice site probably benign
IGL03301:Heatr1 APN 13 12434205 missense probably damaging 1.00
hasan UTSW 13 12417447 splice site probably benign
H8562:Heatr1 UTSW 13 12408713 missense probably benign 0.13
R0226:Heatr1 UTSW 13 12410562 missense probably damaging 1.00
R0571:Heatr1 UTSW 13 12430240 missense probably damaging 0.98
R0722:Heatr1 UTSW 13 12406037 missense probably benign 0.14
R1264:Heatr1 UTSW 13 12424610 unclassified probably benign
R1371:Heatr1 UTSW 13 12417632 missense possibly damaging 0.80
R1388:Heatr1 UTSW 13 12417447 splice site probably benign
R1396:Heatr1 UTSW 13 12406046 missense possibly damaging 0.86
R1519:Heatr1 UTSW 13 12412159 missense probably benign
R1689:Heatr1 UTSW 13 12424625 missense probably benign 0.00
R1696:Heatr1 UTSW 13 12423721 missense possibly damaging 0.96
R1756:Heatr1 UTSW 13 12396460 missense probably benign 0.01
R1859:Heatr1 UTSW 13 12403159 missense probably damaging 1.00
R1932:Heatr1 UTSW 13 12435185 missense probably damaging 1.00
R1957:Heatr1 UTSW 13 12396538 missense probably damaging 1.00
R2018:Heatr1 UTSW 13 12414478 missense possibly damaging 0.68
R2106:Heatr1 UTSW 13 12412058 missense probably benign 0.03
R2119:Heatr1 UTSW 13 12432646 missense probably null 1.00
R2121:Heatr1 UTSW 13 12403264 missense probably benign 0.10
R2122:Heatr1 UTSW 13 12403264 missense probably benign 0.10
R2367:Heatr1 UTSW 13 12433724 missense probably damaging 1.00
R3777:Heatr1 UTSW 13 12413348 missense possibly damaging 0.92
R3783:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3784:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3786:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3787:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3843:Heatr1 UTSW 13 12435121 missense probably benign 0.00
R4533:Heatr1 UTSW 13 12434511 missense probably benign 0.05
R4725:Heatr1 UTSW 13 12424662 nonsense probably null
R4763:Heatr1 UTSW 13 12430930 missense possibly damaging 0.65
R4793:Heatr1 UTSW 13 12431837 missense probably benign 0.00
R4797:Heatr1 UTSW 13 12412048 missense probably benign 0.36
R4798:Heatr1 UTSW 13 12412048 missense probably benign 0.36
R4942:Heatr1 UTSW 13 12413510 critical splice acceptor site probably null
R4952:Heatr1 UTSW 13 12410599 missense probably benign 0.38
R4954:Heatr1 UTSW 13 12407516 critical splice acceptor site probably null
R5370:Heatr1 UTSW 13 12401522 missense probably benign 0.02
R5464:Heatr1 UTSW 13 12433643 missense probably benign 0.00
R5483:Heatr1 UTSW 13 12398914 missense probably damaging 1.00
R5497:Heatr1 UTSW 13 12421064 missense possibly damaging 0.93
R5527:Heatr1 UTSW 13 12402760 missense probably damaging 1.00
R5527:Heatr1 UTSW 13 12404948 missense probably benign
R5836:Heatr1 UTSW 13 12408736 missense probably damaging 0.99
R5916:Heatr1 UTSW 13 12434471 missense probably damaging 1.00
R6018:Heatr1 UTSW 13 12404947 missense probably benign
R6018:Heatr1 UTSW 13 12406058 missense probably benign 0.26
R6216:Heatr1 UTSW 13 12432664 missense probably benign 0.16
R6396:Heatr1 UTSW 13 12406097 missense possibly damaging 0.86
R6472:Heatr1 UTSW 13 12434230 missense probably benign 0.29
R6922:Heatr1 UTSW 13 12435075 missense probably benign 0.00
R7077:Heatr1 UTSW 13 12418164 missense possibly damaging 0.63
R7297:Heatr1 UTSW 13 12421060 nonsense probably null
R7445:Heatr1 UTSW 13 12431038 missense possibly damaging 0.70
R7669:Heatr1 UTSW 13 12411262 missense probably benign 0.33
R7672:Heatr1 UTSW 13 12438664 missense probably damaging 0.96
R7772:Heatr1 UTSW 13 12417641 missense probably benign 0.03
RF011:Heatr1 UTSW 13 12407544 missense probably benign 0.00
Z1176:Heatr1 UTSW 13 12399008 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GTGACAGACTTGATCAATATTAGCC -3'
(R):5'- TGTAATCATGTGACTGCAGGCC -3'

Sequencing Primer
(F):5'- GCATGTGTTAAAATTACGTTTCACTC -3'
(R):5'- TGCACTGGTAGATGCACG -3'
Posted On2016-10-05