Incidental Mutation 'R5505:Mgat4a'
ID430858
Institutional Source Beutler Lab
Gene Symbol Mgat4a
Ensembl Gene ENSMUSG00000026110
Gene Namemannoside acetylglucosaminyltransferase 4, isoenzyme A
Synonyms9530018I07Rik, GnT-IVa
MMRRC Submission 043066-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.287) question?
Stock #R5505 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location37439340-37541016 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37495954 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 108 (I108V)
Ref Sequence ENSEMBL: ENSMUSP00000114175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042161] [ENSMUST00000143636] [ENSMUST00000148047] [ENSMUST00000149791] [ENSMUST00000151952] [ENSMUST00000154819]
Predicted Effect probably benign
Transcript: ENSMUST00000042161
AA Change: I108V

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000038894
Gene: ENSMUSG00000026110
AA Change: I108V

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
coiled coil region 28 63 N/A INTRINSIC
Pfam:Glyco_transf_54 75 380 5.8e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143636
SMART Domains Protein: ENSMUSP00000122909
Gene: ENSMUSG00000026110

DomainStartEndE-ValueType
Pfam:Glyco_transf_54 1 242 1.2e-123 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148047
SMART Domains Protein: ENSMUSP00000118692
Gene: ENSMUSG00000026110

DomainStartEndE-ValueType
Pfam:Glyco_transf_54 1 112 5e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149791
SMART Domains Protein: ENSMUSP00000115778
Gene: ENSMUSG00000026110

DomainStartEndE-ValueType
Pfam:Glyco_transf_54 1 62 2.9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151952
AA Change: I108V

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000114175
Gene: ENSMUSG00000026110
AA Change: I108V

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
coiled coil region 28 63 N/A INTRINSIC
Pfam:Glyco_transf_54 86 380 7.5e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154819
AA Change: I99V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000121181
Gene: ENSMUSG00000026110
AA Change: I99V

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
coiled coil region 28 63 N/A INTRINSIC
Pfam:Glyco_transf_54 71 371 4.8e-137 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194660
Meta Mutation Damage Score 0.1516 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.9%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a key glycosyltransferase that regulates the formation of tri- and multiantennary branching structures in the Golgi apparatus. The encoded protein, in addition to the related isoenzyme B, catalyzes the transfer of N-acetylglucosamine (GlcNAc) from UDP-GlcNAc in a beta-1,4 linkage to the Man-alpha-1,3-Man-beta-1,4-GlcNAc arm of R-Man-alpha-1,6(GlcNAc-beta-1,2-Man-alpha-1,3)Man-beta-1,4-GlcNAc-beta-1,4-GlcNAc-beta-1-Asn. The encoded protein may play a role in regulating the availability of serum glycoproteins, oncogenesis, and differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show defects in glucose-stimulated insulin secretion, impaired cellular glucose import, increased susceptibility to weight gain, hyperglycemia, impaired glucose tolerance, insulin resistance, high free fatty acid and triglyceride levels, and hepatic steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T A 5: 24,401,038 D240E probably damaging Het
Alpk3 G A 7: 81,078,561 E480K possibly damaging Het
Arhgap20 A G 9: 51,838,948 E372G probably damaging Het
Atp23 G T 10: 126,887,630 A201D probably damaging Het
Bpifb1 A G 2: 154,204,779 D73G probably benign Het
Ccdc7a A G 8: 128,980,174 S325P possibly damaging Het
Cckar A G 5: 53,703,068 Y140H probably damaging Het
Cd46 A T 1: 195,085,380 D124E possibly damaging Het
Cep290 T C 10: 100,499,186 probably null Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Eif2ak1 T C 5: 143,817,990 S34P probably benign Het
Enah T A 1: 181,906,453 probably benign Het
Gad2 C G 2: 22,624,833 L108V probably benign Het
Gpr22 T C 12: 31,709,725 I133V probably damaging Het
Hdac4 T C 1: 91,975,465 T13A probably benign Het
Ighv1-4 A G 12: 114,487,437 V17A possibly damaging Het
Ints8 T A 4: 11,221,143 Q744L probably benign Het
Lrit3 C T 3: 129,791,438 V224I possibly damaging Het
Mmp9 T C 2: 164,953,608 I682T probably benign Het
Myh7b G A 2: 155,632,672 A1742T probably benign Het
Nlrp12 C T 7: 3,249,385 G52D probably damaging Het
Olfr1094 T C 2: 86,829,501 F250L possibly damaging Het
Pcnx T C 12: 81,950,153 L941P probably damaging Het
Pla2g4e T C 2: 120,244,775 R45G probably benign Het
Plcz1 C G 6: 140,016,216 G203A probably damaging Het
Poldip2 A G 11: 78,515,175 T76A probably benign Het
Prdm15 T A 16: 97,816,983 H325L possibly damaging Het
Ralyl A T 3: 13,776,920 I39F probably damaging Het
Rnf220 A C 4: 117,296,091 probably benign Het
Rnpc3 T C 3: 113,615,453 K318E probably damaging Het
Rsbn1 T A 3: 103,928,943 N432K probably damaging Het
Sh3yl1 T A 12: 30,942,073 Y176N probably damaging Het
Slc25a30 G A 14: 75,763,349 L272F probably damaging Het
Spag1 T C 15: 36,234,626 V844A probably damaging Het
Srsf5 T C 12: 80,949,083 probably benign Het
Tle2 T A 10: 81,581,740 D223E probably benign Het
Tmem192 A G 8: 64,964,246 E39G possibly damaging Het
Trpc6 T A 9: 8,626,735 L362H probably damaging Het
Tuba4a A G 1: 75,216,416 Y185H probably damaging Het
Uba6 A G 5: 86,120,546 V941A probably benign Het
Vmn2r35 A T 7: 7,786,480 Y753N probably damaging Het
Zfp941 C T 7: 140,811,917 V510I probably benign Het
Other mutations in Mgat4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Mgat4a APN 1 37449123 nonsense probably null
IGL01720:Mgat4a APN 1 37444898 missense probably damaging 1.00
IGL02103:Mgat4a APN 1 37462926 missense possibly damaging 0.94
IGL03177:Mgat4a APN 1 37444887 missense probably damaging 1.00
R0090:Mgat4a UTSW 1 37490333 missense probably damaging 1.00
R0269:Mgat4a UTSW 1 37490307 missense possibly damaging 0.89
R0635:Mgat4a UTSW 1 37452294 missense probably benign 0.11
R1114:Mgat4a UTSW 1 37464406 splice site probably benign
R1120:Mgat4a UTSW 1 37452581 missense probably damaging 1.00
R1466:Mgat4a UTSW 1 37464406 splice site probably benign
R1940:Mgat4a UTSW 1 37536037 critical splice donor site probably null
R2257:Mgat4a UTSW 1 37490313 missense probably benign 0.13
R2293:Mgat4a UTSW 1 37452592 missense probably damaging 0.99
R2370:Mgat4a UTSW 1 37464533 missense probably damaging 0.96
R2392:Mgat4a UTSW 1 37498704 missense probably damaging 1.00
R3952:Mgat4a UTSW 1 37450414 splice site probably benign
R4563:Mgat4a UTSW 1 37466579 missense probably damaging 1.00
R5424:Mgat4a UTSW 1 37466555 missense probably benign 0.01
R5494:Mgat4a UTSW 1 37454817 missense probably damaging 1.00
R5938:Mgat4a UTSW 1 37452263 missense probably damaging 0.99
R6237:Mgat4a UTSW 1 37456592 missense probably damaging 1.00
R6589:Mgat4a UTSW 1 37444895 missense probably damaging 0.99
R6817:Mgat4a UTSW 1 37449123 nonsense probably null
R6825:Mgat4a UTSW 1 37464434 nonsense probably null
R7402:Mgat4a UTSW 1 37454784 missense probably damaging 1.00
R7507:Mgat4a UTSW 1 37452527 missense probably damaging 1.00
R7789:Mgat4a UTSW 1 37490279 missense probably damaging 0.97
X0063:Mgat4a UTSW 1 37462890 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTAAGCCCCAAGATGCTGTG -3'
(R):5'- ACTGCTGCGTAGTTAGTGC -3'

Sequencing Primer
(F):5'- GATGCTGTGCAGatattaaatat -3'
(R):5'- CTGCGTAGTTAGTGCCTGCC -3'
Posted On2016-10-05