Mutagenetix > Incidental Mutations

Incidental Mutation 'R5505:Mgat4a'

430858

Institutional Source

Beutler Lab

Gene Symbol

Mgat4a

Ensembl Gene

ENSMUSG00000026110

Gene Name

mannoside acetylglucosaminyltransferase 4, isoenzyme A

Synonyms

9530018I07Rik, GnT-IVa

MMRRC Submission

043066-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.287) question?

Stock #

R5505 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

37439340-37541016 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 37495954 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 108 (I108V)

Ref Sequence

ENSEMBL: ENSMUSP00000114175 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042161] [ENSMUST00000143636] [ENSMUST00000148047] [ENSMUST00000149791] [ENSMUST00000151952] [ENSMUST00000154819]

Predicted Effect

probably benign
Transcript: ENSMUST00000042161
AA Change: I108V

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000038894
Gene: ENSMUSG00000026110
AA Change: I108V

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
coiled coil region	28	63	N/A	INTRINSIC
Pfam:Glyco_transf_54	75	380	5.8e-137	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000143636

SMART Domains

Protein: ENSMUSP00000122909
Gene: ENSMUSG00000026110

Domain	Start	End	E-Value	Type
Pfam:Glyco_transf_54	1	242	1.2e-123	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000148047

SMART Domains

Protein: ENSMUSP00000118692
Gene: ENSMUSG00000026110

Domain	Start	End	E-Value	Type
Pfam:Glyco_transf_54	1	112	5e-54	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000149791

SMART Domains

Protein: ENSMUSP00000115778
Gene: ENSMUSG00000026110

Domain	Start	End	E-Value	Type
Pfam:Glyco_transf_54	1	62	2.9e-17	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000151952
AA Change: I108V

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000114175
Gene: ENSMUSG00000026110
AA Change: I108V

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
coiled coil region	28	63	N/A	INTRINSIC
Pfam:Glyco_transf_54	86	380	7.5e-139	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000154819
AA Change: I99V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000121181
Gene: ENSMUSG00000026110
AA Change: I99V

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
coiled coil region	28	63	N/A	INTRINSIC
Pfam:Glyco_transf_54	71	371	4.8e-137	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194660

Meta Mutation Damage Score

0.1516

Coding Region Coverage

1x: 98.3%
3x: 97.3%
10x: 95.2%
20x: 90.9%

Validation Efficiency

98% (47/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a key glycosyltransferase that regulates the formation of tri- and multiantennary branching structures in the Golgi apparatus. The encoded protein, in addition to the related isoenzyme B, catalyzes the transfer of N-acetylglucosamine (GlcNAc) from UDP-GlcNAc in a beta-1,4 linkage to the Man-alpha-1,3-Man-beta-1,4-GlcNAc arm of R-Man-alpha-1,6(GlcNAc-beta-1,2-Man-alpha-1,3)Man-beta-1,4-GlcNAc-beta-1,4-GlcNAc-beta-1-Asn. The encoded protein may play a role in regulating the availability of serum glycoproteins, oncogenesis, and differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show defects in glucose-stimulated insulin secretion, impaired cellular glucose import, increased susceptibility to weight gain, hyperglycemia, impaired glucose tolerance, insulin resistance, high free fatty acid and triglyceride levels, and hepatic steatosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb8	T	A	5: 24,401,038	D240E	probably damaging	Het
Alpk3	G	A	7: 81,078,561	E480K	possibly damaging	Het
Arhgap20	A	G	9: 51,838,948	E372G	probably damaging	Het
Atp23	G	T	10: 126,887,630	A201D	probably damaging	Het
Bpifb1	A	G	2: 154,204,779	D73G	probably benign	Het
Ccdc7a	A	G	8: 128,980,174	S325P	possibly damaging	Het
Cckar	A	G	5: 53,703,068	Y140H	probably damaging	Het
Cd46	A	T	1: 195,085,380	D124E	possibly damaging	Het
Cep290	T	C	10: 100,499,186		probably null	Het
Cmklr1	C	G	5: 113,614,929	D4H	possibly damaging	Het
Eif2ak1	T	C	5: 143,817,990	S34P	probably benign	Het
Enah	T	A	1: 181,906,453		probably benign	Het
Gad2	C	G	2: 22,624,833	L108V	probably benign	Het
Gpr22	T	C	12: 31,709,725	I133V	probably damaging	Het
Hdac4	T	C	1: 91,975,465	T13A	probably benign	Het
Ighv1-4	A	G	12: 114,487,437	V17A	possibly damaging	Het
Ints8	T	A	4: 11,221,143	Q744L	probably benign	Het
Lrit3	C	T	3: 129,791,438	V224I	possibly damaging	Het
Mmp9	T	C	2: 164,953,608	I682T	probably benign	Het
Myh7b	G	A	2: 155,632,672	A1742T	probably benign	Het
Nlrp12	C	T	7: 3,249,385	G52D	probably damaging	Het
Olfr1094	T	C	2: 86,829,501	F250L	possibly damaging	Het
Pcnx	T	C	12: 81,950,153	L941P	probably damaging	Het
Pla2g4e	T	C	2: 120,244,775	R45G	probably benign	Het
Plcz1	C	G	6: 140,016,216	G203A	probably damaging	Het
Poldip2	A	G	11: 78,515,175	T76A	probably benign	Het
Prdm15	T	A	16: 97,816,983	H325L	possibly damaging	Het
Ralyl	A	T	3: 13,776,920	I39F	probably damaging	Het
Rnf220	A	C	4: 117,296,091		probably benign	Het
Rnpc3	T	C	3: 113,615,453	K318E	probably damaging	Het
Rsbn1	T	A	3: 103,928,943	N432K	probably damaging	Het
Sh3yl1	T	A	12: 30,942,073	Y176N	probably damaging	Het
Slc25a30	G	A	14: 75,763,349	L272F	probably damaging	Het
Spag1	T	C	15: 36,234,626	V844A	probably damaging	Het
Srsf5	T	C	12: 80,949,083		probably benign	Het
Tle2	T	A	10: 81,581,740	D223E	probably benign	Het
Tmem192	A	G	8: 64,964,246	E39G	possibly damaging	Het
Trpc6	T	A	9: 8,626,735	L362H	probably damaging	Het
Tuba4a	A	G	1: 75,216,416	Y185H	probably damaging	Het
Uba6	A	G	5: 86,120,546	V941A	probably benign	Het
Vmn2r35	A	T	7: 7,786,480	Y753N	probably damaging	Het
Zfp941	C	T	7: 140,811,917	V510I	probably benign	Het

Other mutations in Mgat4a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00508:Mgat4a	APN	1	37449123	nonsense	probably null
IGL01720:Mgat4a	APN	1	37444898	missense	probably damaging	1.00
IGL02103:Mgat4a	APN	1	37462926	missense	possibly damaging	0.94
IGL03177:Mgat4a	APN	1	37444887	missense	probably damaging	1.00
R0090:Mgat4a	UTSW	1	37490333	missense	probably damaging	1.00
R0269:Mgat4a	UTSW	1	37490307	missense	possibly damaging	0.89
R0635:Mgat4a	UTSW	1	37452294	missense	probably benign	0.11
R1114:Mgat4a	UTSW	1	37464406	splice site	probably benign
R1120:Mgat4a	UTSW	1	37452581	missense	probably damaging	1.00
R1466:Mgat4a	UTSW	1	37464406	splice site	probably benign
R1940:Mgat4a	UTSW	1	37536037	critical splice donor site	probably null
R2257:Mgat4a	UTSW	1	37490313	missense	probably benign	0.13
R2293:Mgat4a	UTSW	1	37452592	missense	probably damaging	0.99
R2370:Mgat4a	UTSW	1	37464533	missense	probably damaging	0.96
R2392:Mgat4a	UTSW	1	37498704	missense	probably damaging	1.00
R3952:Mgat4a	UTSW	1	37450414	splice site	probably benign
R4563:Mgat4a	UTSW	1	37466579	missense	probably damaging	1.00
R5424:Mgat4a	UTSW	1	37466555	missense	probably benign	0.01
R5494:Mgat4a	UTSW	1	37454817	missense	probably damaging	1.00
R5938:Mgat4a	UTSW	1	37452263	missense	probably damaging	0.99
R6237:Mgat4a	UTSW	1	37456592	missense	probably damaging	1.00
R6589:Mgat4a	UTSW	1	37444895	missense	probably damaging	0.99
R6817:Mgat4a	UTSW	1	37449123	nonsense	probably null
R6825:Mgat4a	UTSW	1	37464434	nonsense	probably null
R7402:Mgat4a	UTSW	1	37454784	missense	probably damaging	1.00
R7507:Mgat4a	UTSW	1	37452527	missense	probably damaging	1.00
R7789:Mgat4a	UTSW	1	37490279	missense	probably damaging	0.97
X0063:Mgat4a	UTSW	1	37462890	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- CTAAGCCCCAAGATGCTGTG -3'
(R):5'- ACTGCTGCGTAGTTAGTGC -3'

Sequencing Primer
(F):5'- GATGCTGTGCAGatattaaatat -3'
(R):5'- CTGCGTAGTTAGTGCCTGCC -3'

Posted On

2016-10-05