Incidental Mutation 'R5505:Tuba4a'
ID430859
Institutional Source Beutler Lab
Gene Symbol Tuba4a
Ensembl Gene ENSMUSG00000026202
Gene Nametubulin, alpha 4A
SynonymsTuba4, M[a]4
MMRRC Submission 043066-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.438) question?
Stock #R5505 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location75214228-75219865 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75216416 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 185 (Y185H)
Ref Sequence ENSEMBL: ENSMUSP00000140657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027401] [ENSMUST00000123825] [ENSMUST00000144355] [ENSMUST00000179573] [ENSMUST00000180101] [ENSMUST00000186213] [ENSMUST00000186758] [ENSMUST00000188460] [ENSMUST00000188593] [ENSMUST00000189131] [ENSMUST00000189698] [ENSMUST00000190717] [ENSMUST00000191108]
Predicted Effect probably benign
Transcript: ENSMUST00000027401
SMART Domains Protein: ENSMUSP00000027401
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
Pfam:Pkinase 20 290 3.3e-47 PFAM
Pfam:Pkinase_Tyr 21 290 3e-28 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000079464
AA Change: Y213H
SMART Domains Protein: ENSMUSP00000078429
Gene: ENSMUSG00000026202
AA Change: Y213H

DomainStartEndE-ValueType
Tubulin 49 246 4.34e-79 SMART
Tubulin_C 248 393 7.88e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123825
SMART Domains Protein: ENSMUSP00000122688
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
Pfam:Pkinase 20 122 9.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126328
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142052
Predicted Effect probably benign
Transcript: ENSMUST00000144355
SMART Domains Protein: ENSMUSP00000115964
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
Pfam:Pkinase 20 122 9.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156012
Predicted Effect probably benign
Transcript: ENSMUST00000179573
Predicted Effect probably benign
Transcript: ENSMUST00000180101
Predicted Effect probably damaging
Transcript: ENSMUST00000186213
AA Change: Y185H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140657
Gene: ENSMUSG00000026202
AA Change: Y185H

DomainStartEndE-ValueType
Tubulin 49 246 4.34e-79 SMART
Tubulin_C 248 393 7.88e-59 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186492
Predicted Effect probably benign
Transcript: ENSMUST00000186758
SMART Domains Protein: ENSMUSP00000140552
Gene: ENSMUSG00000026202

DomainStartEndE-ValueType
Pfam:Tubulin 1 100 1.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187103
Predicted Effect probably benign
Transcript: ENSMUST00000188460
SMART Domains Protein: ENSMUSP00000139998
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
S_TKc 20 172 1e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188593
SMART Domains Protein: ENSMUSP00000140881
Gene: ENSMUSG00000026202

DomainStartEndE-ValueType
Pfam:Tubulin 2 75 2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189131
SMART Domains Protein: ENSMUSP00000140970
Gene: ENSMUSG00000026202

DomainStartEndE-ValueType
Pfam:Tubulin 1 81 3.6e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189242
Predicted Effect probably benign
Transcript: ENSMUST00000189698
SMART Domains Protein: ENSMUSP00000140329
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
S_TKc 20 203 1.1e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190717
SMART Domains Protein: ENSMUSP00000141097
Gene: ENSMUSG00000026202

DomainStartEndE-ValueType
Pfam:Tubulin 1 89 1.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191108
SMART Domains Protein: ENSMUSP00000139846
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
Pfam:Pkinase 20 186 8.6e-29 PFAM
Pfam:Pkinase_Tyr 21 184 2.1e-14 PFAM
Meta Mutation Damage Score 0.9651 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.9%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Microtubules of the eukaryotic cytoskeleton perform essential and diverse functions and are composed of a heterodimer of alpha and beta tubulin. The genes encoding these microtubule constituents are part of the tubulin superfamily, which is composed of six distinct families. Genes from the alpha, beta and gamma tubulin families are found in all eukaryotes. The alpha and beta tubulins represent the major components of microtubules, while gamma tubulin plays a critical role in the nucleation of microtubule assembly. There are multiple alpha and beta tubulin genes and they are highly conserved among and between species. This gene encodes an alpha tubulin that is a highly conserved homolog of a rat testis-specific alpha tubulin. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T A 5: 24,401,038 D240E probably damaging Het
Alpk3 G A 7: 81,078,561 E480K possibly damaging Het
Arhgap20 A G 9: 51,838,948 E372G probably damaging Het
Atp23 G T 10: 126,887,630 A201D probably damaging Het
Bpifb1 A G 2: 154,204,779 D73G probably benign Het
Ccdc7a A G 8: 128,980,174 S325P possibly damaging Het
Cckar A G 5: 53,703,068 Y140H probably damaging Het
Cd46 A T 1: 195,085,380 D124E possibly damaging Het
Cep290 T C 10: 100,499,186 probably null Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Eif2ak1 T C 5: 143,817,990 S34P probably benign Het
Enah T A 1: 181,906,453 probably benign Het
Gad2 C G 2: 22,624,833 L108V probably benign Het
Gpr22 T C 12: 31,709,725 I133V probably damaging Het
Hdac4 T C 1: 91,975,465 T13A probably benign Het
Ighv1-4 A G 12: 114,487,437 V17A possibly damaging Het
Ints8 T A 4: 11,221,143 Q744L probably benign Het
Lrit3 C T 3: 129,791,438 V224I possibly damaging Het
Mgat4a T C 1: 37,495,954 I108V probably benign Het
Mmp9 T C 2: 164,953,608 I682T probably benign Het
Myh7b G A 2: 155,632,672 A1742T probably benign Het
Nlrp12 C T 7: 3,249,385 G52D probably damaging Het
Olfr1094 T C 2: 86,829,501 F250L possibly damaging Het
Pcnx T C 12: 81,950,153 L941P probably damaging Het
Pla2g4e T C 2: 120,244,775 R45G probably benign Het
Plcz1 C G 6: 140,016,216 G203A probably damaging Het
Poldip2 A G 11: 78,515,175 T76A probably benign Het
Prdm15 T A 16: 97,816,983 H325L possibly damaging Het
Ralyl A T 3: 13,776,920 I39F probably damaging Het
Rnf220 A C 4: 117,296,091 probably benign Het
Rnpc3 T C 3: 113,615,453 K318E probably damaging Het
Rsbn1 T A 3: 103,928,943 N432K probably damaging Het
Sh3yl1 T A 12: 30,942,073 Y176N probably damaging Het
Slc25a30 G A 14: 75,763,349 L272F probably damaging Het
Spag1 T C 15: 36,234,626 V844A probably damaging Het
Srsf5 T C 12: 80,949,083 probably benign Het
Tle2 T A 10: 81,581,740 D223E probably benign Het
Tmem192 A G 8: 64,964,246 E39G possibly damaging Het
Trpc6 T A 9: 8,626,735 L362H probably damaging Het
Uba6 A G 5: 86,120,546 V941A probably benign Het
Vmn2r35 A T 7: 7,786,480 Y753N probably damaging Het
Zfp941 C T 7: 140,811,917 V510I probably benign Het
Other mutations in Tuba4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Tuba4a APN 1 75217277 missense probably damaging 1.00
andropov UTSW 1 75217394 missense probably damaging 1.00
R0453:Tuba4a UTSW 1 75215858 missense probably damaging 1.00
R0573:Tuba4a UTSW 1 75216373 missense probably benign 0.01
R1488:Tuba4a UTSW 1 75216401 missense probably benign 0.08
R1660:Tuba4a UTSW 1 75215903 missense probably benign 0.35
R1836:Tuba4a UTSW 1 75216110 missense probably benign 0.20
R2012:Tuba4a UTSW 1 75216339 nonsense probably null
R2437:Tuba4a UTSW 1 75217425 missense possibly damaging 0.47
R4180:Tuba4a UTSW 1 75215782 missense probably benign 0.33
R6137:Tuba4a UTSW 1 75216055 missense probably damaging 1.00
R6189:Tuba4a UTSW 1 75216874 missense probably benign 0.34
R6566:Tuba4a UTSW 1 75217286 missense probably damaging 1.00
R6837:Tuba4a UTSW 1 75217394 missense probably damaging 1.00
R6883:Tuba4a UTSW 1 75217422 missense probably damaging 1.00
R7213:Tuba4a UTSW 1 75215697 missense possibly damaging 0.86
R7765:Tuba4a UTSW 1 75216359 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CAGGTTGGTCTGGAACTCTG -3'
(R):5'- TGATCAGTGCACAGGACTTC -3'

Sequencing Primer
(F):5'- GAACTCTGTCAGGTCCACATTGAG -3'
(R):5'- ACAGGACTTCAGGGCTTCCTAG -3'
Posted On2016-10-05