Incidental Mutation 'R5505:Olfr1094'
ID430864
Institutional Source Beutler Lab
Gene Symbol Olfr1094
Ensembl Gene ENSMUSG00000044213
Gene Nameolfactory receptor 1094
SynonymsGA_x6K02T2Q125-48321457-48322449, MOR179-7
MMRRC Submission 043066-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R5505 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86824663-86830282 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86829501 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 250 (F250L)
Ref Sequence ENSEMBL: ENSMUSP00000148902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105211] [ENSMUST00000217509]
Predicted Effect possibly damaging
Transcript: ENSMUST00000105211
AA Change: F250L

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000100846
Gene: ENSMUSG00000044213
AA Change: F250L

DomainStartEndE-ValueType
Pfam:7tm_4 43 320 4.6e-52 PFAM
Pfam:7tm_1 53 316 3.5e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000217509
AA Change: F250L

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.2611 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.9%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T A 5: 24,401,038 D240E probably damaging Het
Alpk3 G A 7: 81,078,561 E480K possibly damaging Het
Arhgap20 A G 9: 51,838,948 E372G probably damaging Het
Atp23 G T 10: 126,887,630 A201D probably damaging Het
Bpifb1 A G 2: 154,204,779 D73G probably benign Het
Ccdc7a A G 8: 128,980,174 S325P possibly damaging Het
Cckar A G 5: 53,703,068 Y140H probably damaging Het
Cd46 A T 1: 195,085,380 D124E possibly damaging Het
Cep290 T C 10: 100,499,186 probably null Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Eif2ak1 T C 5: 143,817,990 S34P probably benign Het
Enah T A 1: 181,906,453 probably benign Het
Gad2 C G 2: 22,624,833 L108V probably benign Het
Gpr22 T C 12: 31,709,725 I133V probably damaging Het
Hdac4 T C 1: 91,975,465 T13A probably benign Het
Ighv1-4 A G 12: 114,487,437 V17A possibly damaging Het
Ints8 T A 4: 11,221,143 Q744L probably benign Het
Lrit3 C T 3: 129,791,438 V224I possibly damaging Het
Mgat4a T C 1: 37,495,954 I108V probably benign Het
Mmp9 T C 2: 164,953,608 I682T probably benign Het
Myh7b G A 2: 155,632,672 A1742T probably benign Het
Nlrp12 C T 7: 3,249,385 G52D probably damaging Het
Pcnx T C 12: 81,950,153 L941P probably damaging Het
Pla2g4e T C 2: 120,244,775 R45G probably benign Het
Plcz1 C G 6: 140,016,216 G203A probably damaging Het
Poldip2 A G 11: 78,515,175 T76A probably benign Het
Prdm15 T A 16: 97,816,983 H325L possibly damaging Het
Ralyl A T 3: 13,776,920 I39F probably damaging Het
Rnf220 A C 4: 117,296,091 probably benign Het
Rnpc3 T C 3: 113,615,453 K318E probably damaging Het
Rsbn1 T A 3: 103,928,943 N432K probably damaging Het
Sh3yl1 T A 12: 30,942,073 Y176N probably damaging Het
Slc25a30 G A 14: 75,763,349 L272F probably damaging Het
Spag1 T C 15: 36,234,626 V844A probably damaging Het
Srsf5 T C 12: 80,949,083 probably benign Het
Tle2 T A 10: 81,581,740 D223E probably benign Het
Tmem192 A G 8: 64,964,246 E39G possibly damaging Het
Trpc6 T A 9: 8,626,735 L362H probably damaging Het
Tuba4a A G 1: 75,216,416 Y185H probably damaging Het
Uba6 A G 5: 86,120,546 V941A probably benign Het
Vmn2r35 A T 7: 7,786,480 Y753N probably damaging Het
Zfp941 C T 7: 140,811,917 V510I probably benign Het
Other mutations in Olfr1094
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02839:Olfr1094 APN 2 86829368 missense probably benign
IGL03053:Olfr1094 APN 2 86829263 missense possibly damaging 0.93
IGL03168:Olfr1094 APN 2 86829263 missense possibly damaging 0.93
IGL02799:Olfr1094 UTSW 2 86828956 missense probably damaging 0.99
R0511:Olfr1094 UTSW 2 86829606 missense probably benign 0.02
R0944:Olfr1094 UTSW 2 86828937 missense probably benign 0.01
R1065:Olfr1094 UTSW 2 86829544 missense probably damaging 0.98
R1476:Olfr1094 UTSW 2 86829198 missense probably benign 0.31
R1807:Olfr1094 UTSW 2 86829101 missense probably benign 0.03
R2865:Olfr1094 UTSW 2 86828854 missense probably benign 0.21
R2915:Olfr1094 UTSW 2 86829226 missense probably benign 0.02
R3055:Olfr1094 UTSW 2 86829127 missense possibly damaging 0.94
R3104:Olfr1094 UTSW 2 86829691 missense probably benign 0.03
R4862:Olfr1094 UTSW 2 86829532 missense probably damaging 1.00
R4874:Olfr1094 UTSW 2 86829254 missense probably damaging 0.98
R5507:Olfr1094 UTSW 2 86829317 missense probably damaging 1.00
R6318:Olfr1094 UTSW 2 86829654 missense possibly damaging 0.73
R6538:Olfr1094 UTSW 2 86829525 missense possibly damaging 0.55
R8058:Olfr1094 UTSW 2 86829708 missense probably benign 0.01
R8285:Olfr1094 UTSW 2 86829099 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCTACTATACATACAGTGGCTACC -3'
(R):5'- TGTTTCTCAGACTGTAGATGATAGG -3'

Sequencing Primer
(F):5'- CTGTGCATCCAATGAGATTAGGC -3'
(R):5'- TCAGACTGTAGATGATAGGATTCAGC -3'
Posted On2016-10-05