Incidental Mutation 'R5505:Ints8'
ID430873
Institutional Source Beutler Lab
Gene Symbol Ints8
Ensembl Gene ENSMUSG00000040738
Gene Nameintegrator complex subunit 8
Synonyms2810013E07Rik, D130008D20Rik
MMRRC Submission 043066-MU
Accession Numbers

Ncbi RefSeq: NM_001159595.1, NM_178112.5; MGI:1919906

Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R5505 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location11199158-11254258 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 11221143 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 744 (Q744L)
Ref Sequence ENSEMBL: ENSMUSP00000103955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044616] [ENSMUST00000108318] [ENSMUST00000108319]
Predicted Effect probably benign
Transcript: ENSMUST00000044616
AA Change: Q744L

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000038418
Gene: ENSMUSG00000040738
AA Change: Q744L

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108318
AA Change: Q744L

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000103954
Gene: ENSMUSG00000040738
AA Change: Q744L

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
SCOP:d1a17__ 826 961 9e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108319
AA Change: Q744L

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000103955
Gene: ENSMUSG00000040738
AA Change: Q744L

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137054
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.9%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the Integrator complex which is involved in the cleavage of small nuclear RNAs U1 and U2 within the nucleus. The encoded protein associates with RNA polymerase II and is recruited to the U1 and U2 small nuclear RNA genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Allele List at MGI

All alleles(14) : Targeted(1) Gene trapped(13)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T A 5: 24,401,038 D240E probably damaging Het
Alpk3 G A 7: 81,078,561 E480K possibly damaging Het
Arhgap20 A G 9: 51,838,948 E372G probably damaging Het
Atp23 G T 10: 126,887,630 A201D probably damaging Het
Bpifb1 A G 2: 154,204,779 D73G probably benign Het
Ccdc7a A G 8: 128,980,174 S325P possibly damaging Het
Cckar A G 5: 53,703,068 Y140H probably damaging Het
Cd46 A T 1: 195,085,380 D124E possibly damaging Het
Cep290 T C 10: 100,499,186 probably null Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Eif2ak1 T C 5: 143,817,990 S34P probably benign Het
Enah T A 1: 181,906,453 probably benign Het
Gad2 C G 2: 22,624,833 L108V probably benign Het
Gpr22 T C 12: 31,709,725 I133V probably damaging Het
Hdac4 T C 1: 91,975,465 T13A probably benign Het
Ighv1-4 A G 12: 114,487,437 V17A possibly damaging Het
Lrit3 C T 3: 129,791,438 V224I possibly damaging Het
Mgat4a T C 1: 37,495,954 I108V probably benign Het
Mmp9 T C 2: 164,953,608 I682T probably benign Het
Myh7b G A 2: 155,632,672 A1742T probably benign Het
Nlrp12 C T 7: 3,249,385 G52D probably damaging Het
Olfr1094 T C 2: 86,829,501 F250L possibly damaging Het
Pcnx T C 12: 81,950,153 L941P probably damaging Het
Pla2g4e T C 2: 120,244,775 R45G probably benign Het
Plcz1 C G 6: 140,016,216 G203A probably damaging Het
Poldip2 A G 11: 78,515,175 T76A probably benign Het
Prdm15 T A 16: 97,816,983 H325L possibly damaging Het
Ralyl A T 3: 13,776,920 I39F probably damaging Het
Rnf220 A C 4: 117,296,091 probably benign Het
Rnpc3 T C 3: 113,615,453 K318E probably damaging Het
Rsbn1 T A 3: 103,928,943 N432K probably damaging Het
Sh3yl1 T A 12: 30,942,073 Y176N probably damaging Het
Slc25a30 G A 14: 75,763,349 L272F probably damaging Het
Spag1 T C 15: 36,234,626 V844A probably damaging Het
Srsf5 T C 12: 80,949,083 probably benign Het
Tle2 T A 10: 81,581,740 D223E probably benign Het
Tmem192 A G 8: 64,964,246 E39G possibly damaging Het
Trpc6 T A 9: 8,626,735 L362H probably damaging Het
Tuba4a A G 1: 75,216,416 Y185H probably damaging Het
Uba6 A G 5: 86,120,546 V941A probably benign Het
Vmn2r35 A T 7: 7,786,480 Y753N probably damaging Het
Zfp941 C T 7: 140,811,917 V510I probably benign Het
Other mutations in Ints8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Ints8 APN 4 11218679 splice site probably benign
IGL01925:Ints8 APN 4 11235617 splice site probably benign
IGL02195:Ints8 APN 4 11221222 missense probably damaging 1.00
IGL02215:Ints8 APN 4 11209244 missense probably damaging 1.00
IGL02429:Ints8 APN 4 11231720 missense probably damaging 1.00
IGL02484:Ints8 APN 4 11208834 nonsense probably null
IGL02558:Ints8 APN 4 11218771 missense probably damaging 1.00
IGL02725:Ints8 APN 4 11239406 missense probably benign 0.01
IGL02742:Ints8 APN 4 11241627 missense possibly damaging 0.75
IGL02831:Ints8 APN 4 11245896 missense possibly damaging 0.51
IGL03140:Ints8 APN 4 11235565 missense probably damaging 1.00
IGL03171:Ints8 APN 4 11231702 missense probably benign 0.01
IGL03335:Ints8 APN 4 11216460 missense probably damaging 1.00
P0026:Ints8 UTSW 4 11225788 nonsense probably null
R0054:Ints8 UTSW 4 11204595 utr 3 prime probably benign
R0063:Ints8 UTSW 4 11252857 missense probably damaging 1.00
R0063:Ints8 UTSW 4 11252857 missense probably damaging 1.00
R0184:Ints8 UTSW 4 11218637 missense probably benign 0.03
R0299:Ints8 UTSW 4 11246097 missense probably benign 0.04
R0499:Ints8 UTSW 4 11246097 missense probably benign 0.04
R0540:Ints8 UTSW 4 11252926 missense possibly damaging 0.94
R0657:Ints8 UTSW 4 11246097 missense probably benign 0.04
R1232:Ints8 UTSW 4 11234587 missense possibly damaging 0.81
R1296:Ints8 UTSW 4 11221204 missense possibly damaging 0.95
R1390:Ints8 UTSW 4 11239461 missense probably benign 0.22
R1503:Ints8 UTSW 4 11245842 missense probably damaging 0.97
R1587:Ints8 UTSW 4 11245722 critical splice donor site probably null
R1701:Ints8 UTSW 4 11231656 missense probably damaging 1.00
R1721:Ints8 UTSW 4 11241684 missense probably damaging 0.97
R1757:Ints8 UTSW 4 11254109 start codon destroyed probably null 0.99
R1777:Ints8 UTSW 4 11225600 critical splice donor site probably null
R1867:Ints8 UTSW 4 11241684 missense probably damaging 0.97
R1868:Ints8 UTSW 4 11241684 missense probably damaging 0.97
R1952:Ints8 UTSW 4 11221150 missense probably benign 0.21
R2084:Ints8 UTSW 4 11230377 missense probably benign 0.31
R2108:Ints8 UTSW 4 11235552 missense probably damaging 0.99
R2202:Ints8 UTSW 4 11225712 missense possibly damaging 0.79
R2203:Ints8 UTSW 4 11225712 missense possibly damaging 0.79
R2205:Ints8 UTSW 4 11225712 missense possibly damaging 0.79
R2439:Ints8 UTSW 4 11225725 missense probably benign 0.29
R2504:Ints8 UTSW 4 11241642 missense probably benign 0.03
R3824:Ints8 UTSW 4 11225621 nonsense probably null
R4664:Ints8 UTSW 4 11227152 missense probably benign 0.04
R4703:Ints8 UTSW 4 11223785 missense possibly damaging 0.92
R4895:Ints8 UTSW 4 11230367 nonsense probably null
R5206:Ints8 UTSW 4 11216477 missense possibly damaging 0.65
R5262:Ints8 UTSW 4 11211916 missense probably damaging 1.00
R5513:Ints8 UTSW 4 11248303 missense possibly damaging 0.79
R5750:Ints8 UTSW 4 11241654 missense possibly damaging 0.81
R5892:Ints8 UTSW 4 11223813 missense probably damaging 1.00
R6007:Ints8 UTSW 4 11208845 missense possibly damaging 0.70
R6229:Ints8 UTSW 4 11252891 missense probably damaging 1.00
R6466:Ints8 UTSW 4 11252878 missense probably damaging 0.99
R6709:Ints8 UTSW 4 11221117 missense possibly damaging 0.65
R6986:Ints8 UTSW 4 11204474 missense probably damaging 1.00
R6998:Ints8 UTSW 4 11204537 missense possibly damaging 0.80
R7074:Ints8 UTSW 4 11204574 missense possibly damaging 0.82
R7221:Ints8 UTSW 4 11225613 missense probably benign 0.01
R7772:Ints8 UTSW 4 11227190 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCCAATACTTTGCCAGTGAG -3'
(R):5'- GGGGAGTTATCTATGTCTTCCCTC -3'

Sequencing Primer
(F):5'- AATACTTTGCCAGTGAGCTCCAC -3'
(R):5'- CTCCATTGTGCCCTTATTATAAGAC -3'
Posted On2016-10-05