Incidental Mutation 'R5505:Cckar'
ID430877
Institutional Source Beutler Lab
Gene Symbol Cckar
Ensembl Gene ENSMUSG00000029193
Gene Namecholecystokinin A receptor
Synonyms
MMRRC Submission 043066-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R5505 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location53697776-53707705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53703068 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 140 (Y140H)
Ref Sequence ENSEMBL: ENSMUSP00000031093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031093] [ENSMUST00000200691]
Predicted Effect probably damaging
Transcript: ENSMUST00000031093
AA Change: Y140H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031093
Gene: ENSMUSG00000029193
AA Change: Y140H

DomainStartEndE-ValueType
Pfam:CholecysA-Rec_N 1 47 8.8e-29 PFAM
Pfam:7tm_4 48 252 7.2e-12 PFAM
Pfam:7TM_GPCR_Srsx 52 393 2.6e-10 PFAM
Pfam:7tm_1 58 378 1.1e-66 PFAM
low complexity region 399 416 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200691
AA Change: Y69H

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144103
Gene: ENSMUSG00000029193
AA Change: Y69H

DomainStartEndE-ValueType
Pfam:7tm_1 1 307 1.6e-59 PFAM
Pfam:7tm_4 3 181 1.8e-6 PFAM
low complexity region 328 345 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202946
Meta Mutation Damage Score 0.6041 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.9%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G-protein coupled receptor that binds non-sulfated members of the cholecystokinin (CCK) family of peptide hormones. This receptor is a major physiologic mediator of pancreatic enzyme secretion and smooth muscle contraction of the gallbladder and stomach. In the central and peripheral nervous system this receptor regulates satiety and the release of beta-endorphin and dopamine. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice cannot regulate core body temperature in response to changes in ambient temperature. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T A 5: 24,401,038 D240E probably damaging Het
Alpk3 G A 7: 81,078,561 E480K possibly damaging Het
Arhgap20 A G 9: 51,838,948 E372G probably damaging Het
Atp23 G T 10: 126,887,630 A201D probably damaging Het
Bpifb1 A G 2: 154,204,779 D73G probably benign Het
Ccdc7a A G 8: 128,980,174 S325P possibly damaging Het
Cd46 A T 1: 195,085,380 D124E possibly damaging Het
Cep290 T C 10: 100,499,186 probably null Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Eif2ak1 T C 5: 143,817,990 S34P probably benign Het
Enah T A 1: 181,906,453 probably benign Het
Gad2 C G 2: 22,624,833 L108V probably benign Het
Gpr22 T C 12: 31,709,725 I133V probably damaging Het
Hdac4 T C 1: 91,975,465 T13A probably benign Het
Ighv1-4 A G 12: 114,487,437 V17A possibly damaging Het
Ints8 T A 4: 11,221,143 Q744L probably benign Het
Lrit3 C T 3: 129,791,438 V224I possibly damaging Het
Mgat4a T C 1: 37,495,954 I108V probably benign Het
Mmp9 T C 2: 164,953,608 I682T probably benign Het
Myh7b G A 2: 155,632,672 A1742T probably benign Het
Nlrp12 C T 7: 3,249,385 G52D probably damaging Het
Olfr1094 T C 2: 86,829,501 F250L possibly damaging Het
Pcnx T C 12: 81,950,153 L941P probably damaging Het
Pla2g4e T C 2: 120,244,775 R45G probably benign Het
Plcz1 C G 6: 140,016,216 G203A probably damaging Het
Poldip2 A G 11: 78,515,175 T76A probably benign Het
Prdm15 T A 16: 97,816,983 H325L possibly damaging Het
Ralyl A T 3: 13,776,920 I39F probably damaging Het
Rnf220 A C 4: 117,296,091 probably benign Het
Rnpc3 T C 3: 113,615,453 K318E probably damaging Het
Rsbn1 T A 3: 103,928,943 N432K probably damaging Het
Sh3yl1 T A 12: 30,942,073 Y176N probably damaging Het
Slc25a30 G A 14: 75,763,349 L272F probably damaging Het
Spag1 T C 15: 36,234,626 V844A probably damaging Het
Srsf5 T C 12: 80,949,083 probably benign Het
Tle2 T A 10: 81,581,740 D223E probably benign Het
Tmem192 A G 8: 64,964,246 E39G possibly damaging Het
Trpc6 T A 9: 8,626,735 L362H probably damaging Het
Tuba4a A G 1: 75,216,416 Y185H probably damaging Het
Uba6 A G 5: 86,120,546 V941A probably benign Het
Vmn2r35 A T 7: 7,786,480 Y753N probably damaging Het
Zfp941 C T 7: 140,811,917 V510I probably benign Het
Other mutations in Cckar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Cckar APN 5 53699829 missense possibly damaging 0.86
IGL00568:Cckar APN 5 53707301 missense probably benign 0.02
IGL00766:Cckar APN 5 53700036 missense probably damaging 0.99
IGL00960:Cckar APN 5 53701292 missense probably damaging 1.00
IGL02424:Cckar APN 5 53706428 missense possibly damaging 0.63
IGL03002:Cckar APN 5 53702905 missense probably damaging 0.99
R0167:Cckar UTSW 5 53706453 missense probably damaging 1.00
R0302:Cckar UTSW 5 53700299 frame shift probably null
R0366:Cckar UTSW 5 53700165 missense probably benign 0.01
R0391:Cckar UTSW 5 53706253 critical splice donor site probably null
R0981:Cckar UTSW 5 53706290 missense probably damaging 1.00
R1619:Cckar UTSW 5 53700067 missense probably damaging 1.00
R1644:Cckar UTSW 5 53699873 missense probably benign
R1779:Cckar UTSW 5 53699979 missense probably damaging 1.00
R2184:Cckar UTSW 5 53702912 missense probably damaging 0.96
R4290:Cckar UTSW 5 53706497 missense probably benign
R4291:Cckar UTSW 5 53706497 missense probably benign
R4292:Cckar UTSW 5 53706497 missense probably benign
R4294:Cckar UTSW 5 53706497 missense probably benign
R4518:Cckar UTSW 5 53699922 missense probably damaging 1.00
R4583:Cckar UTSW 5 53699782 missense probably benign 0.01
R5139:Cckar UTSW 5 53702923 missense probably benign 0.00
R6207:Cckar UTSW 5 53699844 missense probably benign
R6415:Cckar UTSW 5 53703056 missense probably damaging 1.00
R7127:Cckar UTSW 5 53706475 missense probably damaging 1.00
R7372:Cckar UTSW 5 53707282 missense probably damaging 0.99
X0028:Cckar UTSW 5 53707273 missense probably benign 0.22
X0028:Cckar UTSW 5 53707274 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACAGGAAGCGGCACATGTTC -3'
(R):5'- CGTTTCAGTACAAAACCGGG -3'

Sequencing Primer
(F):5'- ACATGTTCGCCGTCTGG -3'
(R):5'- TTTCAGTACAAAACCGGGACTAAATC -3'
Posted On2016-10-05