Incidental Mutation 'R5505:Zfp941'
ID430884
Institutional Source Beutler Lab
Gene Symbol Zfp941
Ensembl Gene ENSMUSG00000060314
Gene Namezinc finger protein 941
SynonymsBC066028
MMRRC Submission 043066-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5505 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140807449-140822178 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 140811917 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 510 (V510I)
Ref Sequence ENSEMBL: ENSMUSP00000101667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080651] [ENSMUST00000106052] [ENSMUST00000150053]
Predicted Effect probably benign
Transcript: ENSMUST00000080651
AA Change: V510I

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000079482
Gene: ENSMUSG00000060314
AA Change: V510I

DomainStartEndE-ValueType
KRAB 4 65 3.88e-21 SMART
ZnF_C2H2 339 361 1.26e-2 SMART
ZnF_C2H2 367 389 1.12e-3 SMART
ZnF_C2H2 395 417 7.78e-3 SMART
ZnF_C2H2 423 445 1.12e-3 SMART
ZnF_C2H2 451 471 1.16e1 SMART
ZnF_C2H2 500 522 2.57e-3 SMART
ZnF_C2H2 528 550 7.9e-4 SMART
ZnF_C2H2 556 578 6.42e-4 SMART
ZnF_C2H2 584 606 1.38e-3 SMART
ZnF_C2H2 612 634 3.69e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106052
AA Change: V510I

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000101667
Gene: ENSMUSG00000060314
AA Change: V510I

DomainStartEndE-ValueType
KRAB 4 65 3.88e-21 SMART
ZnF_C2H2 339 361 1.26e-2 SMART
ZnF_C2H2 367 389 1.12e-3 SMART
ZnF_C2H2 395 417 7.78e-3 SMART
ZnF_C2H2 423 445 1.12e-3 SMART
ZnF_C2H2 451 471 1.16e1 SMART
ZnF_C2H2 500 522 2.57e-3 SMART
ZnF_C2H2 528 550 7.9e-4 SMART
ZnF_C2H2 556 578 6.42e-4 SMART
ZnF_C2H2 584 606 1.38e-3 SMART
ZnF_C2H2 612 634 3.69e-4 SMART
ZnF_C2H2 640 662 2.99e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150053
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.9%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T A 5: 24,401,038 D240E probably damaging Het
Alpk3 G A 7: 81,078,561 E480K possibly damaging Het
Arhgap20 A G 9: 51,838,948 E372G probably damaging Het
Atp23 G T 10: 126,887,630 A201D probably damaging Het
Bpifb1 A G 2: 154,204,779 D73G probably benign Het
Ccdc7a A G 8: 128,980,174 S325P possibly damaging Het
Cckar A G 5: 53,703,068 Y140H probably damaging Het
Cd46 A T 1: 195,085,380 D124E possibly damaging Het
Cep290 T C 10: 100,499,186 probably null Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Eif2ak1 T C 5: 143,817,990 S34P probably benign Het
Enah T A 1: 181,906,453 probably benign Het
Gad2 C G 2: 22,624,833 L108V probably benign Het
Gpr22 T C 12: 31,709,725 I133V probably damaging Het
Hdac4 T C 1: 91,975,465 T13A probably benign Het
Ighv1-4 A G 12: 114,487,437 V17A possibly damaging Het
Ints8 T A 4: 11,221,143 Q744L probably benign Het
Lrit3 C T 3: 129,791,438 V224I possibly damaging Het
Mgat4a T C 1: 37,495,954 I108V probably benign Het
Mmp9 T C 2: 164,953,608 I682T probably benign Het
Myh7b G A 2: 155,632,672 A1742T probably benign Het
Nlrp12 C T 7: 3,249,385 G52D probably damaging Het
Olfr1094 T C 2: 86,829,501 F250L possibly damaging Het
Pcnx T C 12: 81,950,153 L941P probably damaging Het
Pla2g4e T C 2: 120,244,775 R45G probably benign Het
Plcz1 C G 6: 140,016,216 G203A probably damaging Het
Poldip2 A G 11: 78,515,175 T76A probably benign Het
Prdm15 T A 16: 97,816,983 H325L possibly damaging Het
Ralyl A T 3: 13,776,920 I39F probably damaging Het
Rnf220 A C 4: 117,296,091 probably benign Het
Rnpc3 T C 3: 113,615,453 K318E probably damaging Het
Rsbn1 T A 3: 103,928,943 N432K probably damaging Het
Sh3yl1 T A 12: 30,942,073 Y176N probably damaging Het
Slc25a30 G A 14: 75,763,349 L272F probably damaging Het
Spag1 T C 15: 36,234,626 V844A probably damaging Het
Srsf5 T C 12: 80,949,083 probably benign Het
Tle2 T A 10: 81,581,740 D223E probably benign Het
Tmem192 A G 8: 64,964,246 E39G possibly damaging Het
Trpc6 T A 9: 8,626,735 L362H probably damaging Het
Tuba4a A G 1: 75,216,416 Y185H probably damaging Het
Uba6 A G 5: 86,120,546 V941A probably benign Het
Vmn2r35 A T 7: 7,786,480 Y753N probably damaging Het
Other mutations in Zfp941
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Zfp941 APN 7 140811928 missense probably damaging 1.00
IGL02399:Zfp941 APN 7 140812699 missense probably benign 0.37
IGL03202:Zfp941 APN 7 140813053 missense probably benign 0.02
R0025:Zfp941 UTSW 7 140813272 missense probably benign 0.01
R0025:Zfp941 UTSW 7 140813272 missense probably benign 0.01
R0226:Zfp941 UTSW 7 140813275 missense probably damaging 1.00
R0945:Zfp941 UTSW 7 140811664 missense probably damaging 0.99
R1455:Zfp941 UTSW 7 140812774 missense probably benign 0.29
R1581:Zfp941 UTSW 7 140812120 missense probably benign 0.03
R2474:Zfp941 UTSW 7 140811471 missense probably damaging 1.00
R4052:Zfp941 UTSW 7 140812427 missense possibly damaging 0.81
R4576:Zfp941 UTSW 7 140811590 nonsense probably null
R4604:Zfp941 UTSW 7 140812211 missense probably damaging 1.00
R5170:Zfp941 UTSW 7 140812957 unclassified probably benign
R5311:Zfp941 UTSW 7 140811959 nonsense probably null
R5549:Zfp941 UTSW 7 140808108 missense possibly damaging 0.46
R5566:Zfp941 UTSW 7 140812766 missense probably benign 0.01
R5723:Zfp941 UTSW 7 140812850 unclassified probably benign
R5736:Zfp941 UTSW 7 140813060 missense probably benign 0.01
R5861:Zfp941 UTSW 7 140812139 missense probably damaging 1.00
R6041:Zfp941 UTSW 7 140812245 nonsense probably null
R6058:Zfp941 UTSW 7 140812097 missense probably damaging 1.00
R6226:Zfp941 UTSW 7 140812485 missense probably benign 0.01
R6488:Zfp941 UTSW 7 140812750 missense probably benign 0.37
R6824:Zfp941 UTSW 7 140812699 missense probably benign 0.37
R7356:Zfp941 UTSW 7 140812115 missense possibly damaging 0.66
R7554:Zfp941 UTSW 7 140812057 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- AGTATGAACTCGCTGGTGCTC -3'
(R):5'- TCAGACCTTAATGTACATCAGAGAAGT -3'

Sequencing Primer
(F):5'- AACTCGCTGGTGCTCTGTAAG -3'
(R):5'- GGATTCACACTGGAGAGAAACCTTTC -3'
Posted On2016-10-05