Mutagenetix > Incidental Mutations

Incidental Mutation 'R5505:Trpc6'

430887

Institutional Source

Beutler Lab

Gene Symbol

Trpc6

Ensembl Gene

ENSMUSG00000031997

Gene Name

transient receptor potential cation channel, subfamily C, member 6

Synonyms

mtrp6, Trrp6

MMRRC Submission

043066-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5505 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

8544142-8680741 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 8626735 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Histidine at position 362 (L362H)

Ref Sequence

ENSEMBL: ENSMUSP00000150193 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050433] [ENSMUST00000214596] [ENSMUST00000217462]

Predicted Effect

probably damaging
Transcript: ENSMUST00000050433
AA Change: L362H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000057965
Gene: ENSMUSG00000031997
AA Change: L362H

Domain	Start	End	E-Value	Type
low complexity region	37	54	N/A	INTRINSIC
ANK	96	125	4.73e2	SMART
ANK	131	159	3.49e0	SMART
ANK	217	246	6.61e-1	SMART
Pfam:TRP_2	252	314	4e-29	PFAM
transmembrane domain	406	427	N/A	INTRINSIC
Pfam:Ion_trans	442	738	4.2e-38	PFAM
Pfam:PKD_channel	477	733	3.1e-16	PFAM
low complexity region	770	781	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000214596
AA Change: L362H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000217462
AA Change: L362H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.9344

Coding Region Coverage

1x: 98.3%
3x: 97.3%
10x: 95.2%
20x: 90.9%

Validation Efficiency

98% (47/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a receptor-activated calcium channel in the cell membrane. The channel is activated by diacylglycerol and is thought to be under the control of a phosphatidylinositol second messenger system. Activation of this channel occurs independently of protein kinase C and is not triggered by low levels of intracellular calcium. Defects in this gene are a cause of focal segmental glomerulosclerosis 2 (FSGS2). [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for one null targeted mutation are viable and fertile and exhibit no overt abnormal phenotype. Another knockout results in an increase in thermal nociceptive response latency. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb8	T	A	5: 24,401,038	D240E	probably damaging	Het
Alpk3	G	A	7: 81,078,561	E480K	possibly damaging	Het
Arhgap20	A	G	9: 51,838,948	E372G	probably damaging	Het
Atp23	G	T	10: 126,887,630	A201D	probably damaging	Het
Bpifb1	A	G	2: 154,204,779	D73G	probably benign	Het
Ccdc7a	A	G	8: 128,980,174	S325P	possibly damaging	Het
Cckar	A	G	5: 53,703,068	Y140H	probably damaging	Het
Cd46	A	T	1: 195,085,380	D124E	possibly damaging	Het
Cep290	T	C	10: 100,499,186		probably null	Het
Cmklr1	C	G	5: 113,614,929	D4H	possibly damaging	Het
Eif2ak1	T	C	5: 143,817,990	S34P	probably benign	Het
Enah	T	A	1: 181,906,453		probably benign	Het
Gad2	C	G	2: 22,624,833	L108V	probably benign	Het
Gpr22	T	C	12: 31,709,725	I133V	probably damaging	Het
Hdac4	T	C	1: 91,975,465	T13A	probably benign	Het
Ighv1-4	A	G	12: 114,487,437	V17A	possibly damaging	Het
Ints8	T	A	4: 11,221,143	Q744L	probably benign	Het
Lrit3	C	T	3: 129,791,438	V224I	possibly damaging	Het
Mgat4a	T	C	1: 37,495,954	I108V	probably benign	Het
Mmp9	T	C	2: 164,953,608	I682T	probably benign	Het
Myh7b	G	A	2: 155,632,672	A1742T	probably benign	Het
Nlrp12	C	T	7: 3,249,385	G52D	probably damaging	Het
Olfr1094	T	C	2: 86,829,501	F250L	possibly damaging	Het
Pcnx	T	C	12: 81,950,153	L941P	probably damaging	Het
Pla2g4e	T	C	2: 120,244,775	R45G	probably benign	Het
Plcz1	C	G	6: 140,016,216	G203A	probably damaging	Het
Poldip2	A	G	11: 78,515,175	T76A	probably benign	Het
Prdm15	T	A	16: 97,816,983	H325L	possibly damaging	Het
Ralyl	A	T	3: 13,776,920	I39F	probably damaging	Het
Rnf220	A	C	4: 117,296,091		probably benign	Het
Rnpc3	T	C	3: 113,615,453	K318E	probably damaging	Het
Rsbn1	T	A	3: 103,928,943	N432K	probably damaging	Het
Sh3yl1	T	A	12: 30,942,073	Y176N	probably damaging	Het
Slc25a30	G	A	14: 75,763,349	L272F	probably damaging	Het
Spag1	T	C	15: 36,234,626	V844A	probably damaging	Het
Srsf5	T	C	12: 80,949,083		probably benign	Het
Tle2	T	A	10: 81,581,740	D223E	probably benign	Het
Tmem192	A	G	8: 64,964,246	E39G	possibly damaging	Het
Tuba4a	A	G	1: 75,216,416	Y185H	probably damaging	Het
Uba6	A	G	5: 86,120,546	V941A	probably benign	Het
Vmn2r35	A	T	7: 7,786,480	Y753N	probably damaging	Het
Zfp941	C	T	7: 140,811,917	V510I	probably benign	Het

Other mutations in Trpc6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Trpc6	APN	9	8680438	missense	probably damaging	1.00
IGL00469:Trpc6	APN	9	8626701	missense	probably benign
IGL00970:Trpc6	APN	9	8653151	missense	probably damaging	1.00
IGL01299:Trpc6	APN	9	8653061	missense	probably damaging	1.00
IGL01563:Trpc6	APN	9	8656603	missense	probably damaging	1.00
IGL01578:Trpc6	APN	9	8634057	missense	probably damaging	1.00
IGL02657:Trpc6	APN	9	8643601	missense	possibly damaging	0.94
IGL02735:Trpc6	APN	9	8655338	missense	probably damaging	1.00
IGL03102:Trpc6	APN	9	8649301	missense	probably benign	0.07
P0038:Trpc6	UTSW	9	8649511	missense	possibly damaging	0.52
PIT4531001:Trpc6	UTSW	9	8610148	missense	probably benign	0.14
R0100:Trpc6	UTSW	9	8653034	missense	probably damaging	1.00
R0100:Trpc6	UTSW	9	8653034	missense	probably damaging	1.00
R0323:Trpc6	UTSW	9	8610275	missense	probably damaging	1.00
R0323:Trpc6	UTSW	9	8643536	missense	probably damaging	1.00
R0334:Trpc6	UTSW	9	8610343	missense	probably damaging	1.00
R0665:Trpc6	UTSW	9	8634122	missense	probably benign	0.11
R0948:Trpc6	UTSW	9	8610415	missense	possibly damaging	0.60
R1177:Trpc6	UTSW	9	8658304	missense	probably benign	0.04
R1217:Trpc6	UTSW	9	8658286	intron	probably null
R1445:Trpc6	UTSW	9	8680537	missense	probably benign	0.00
R1452:Trpc6	UTSW	9	8653147	missense	probably damaging	0.99
R1494:Trpc6	UTSW	9	8658304	missense	probably benign	0.04
R1501:Trpc6	UTSW	9	8610169	missense	probably damaging	0.99
R1933:Trpc6	UTSW	9	8656545	missense	probably damaging	1.00
R2112:Trpc6	UTSW	9	8656612	missense	probably damaging	1.00
R2164:Trpc6	UTSW	9	8610465	nonsense	probably null
R2921:Trpc6	UTSW	9	8653033	missense	possibly damaging	0.94
R2995:Trpc6	UTSW	9	8544466	missense	probably benign	0.30
R3821:Trpc6	UTSW	9	8610278	missense	probably damaging	1.00
R3965:Trpc6	UTSW	9	8626621	missense	probably damaging	1.00
R4360:Trpc6	UTSW	9	8610266	missense	probably benign	0.10
R4625:Trpc6	UTSW	9	8677962	missense	probably benign	0.40
R4691:Trpc6	UTSW	9	8652978	missense	probably damaging	1.00
R4736:Trpc6	UTSW	9	8609870	missense	probably damaging	1.00
R4767:Trpc6	UTSW	9	8643686	missense	probably damaging	1.00
R4773:Trpc6	UTSW	9	8609851	missense	possibly damaging	0.78
R4792:Trpc6	UTSW	9	8626614	missense	probably benign	0.00
R5105:Trpc6	UTSW	9	8649470	missense	probably benign
R5319:Trpc6	UTSW	9	8609921	missense	probably damaging	1.00
R5429:Trpc6	UTSW	9	8634074	nonsense	probably null
R5657:Trpc6	UTSW	9	8609807	missense	probably benign	0.11
R5684:Trpc6	UTSW	9	8653128	missense	probably damaging	1.00
R5722:Trpc6	UTSW	9	8680549	missense	possibly damaging	0.88
R6210:Trpc6	UTSW	9	8656730	missense	probably benign	0.42
R6284:Trpc6	UTSW	9	8643600	missense	possibly damaging	0.93
R6773:Trpc6	UTSW	9	8634057	missense	probably damaging	1.00
R6874:Trpc6	UTSW	9	8680438	missense	probably damaging	1.00
R7032:Trpc6	UTSW	9	8609950	missense	probably damaging	1.00
R7142:Trpc6	UTSW	9	8653016	nonsense	probably null
R7489:Trpc6	UTSW	9	8656544	missense	probably benign	0.00
R7631:Trpc6	UTSW	9	8626701	missense	probably benign
R7762:Trpc6	UTSW	9	8653149	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- GCATGGAATATGAGTTAGCTCTTC -3'
(R):5'- TGACTGTGATATTCCACATCCAAAGG -3'

Sequencing Primer
(F):5'- GCTCTTCTTGTTTTAACTATACCCTC -3'
(R):5'- GGCCAGGATTTTAATGACTAACCAGC -3'

Posted On

2016-10-05