Incidental Mutation 'R5505:Sh3yl1'
ID430893
Institutional Source Beutler Lab
Gene Symbol Sh3yl1
Ensembl Gene ENSMUSG00000020669
Gene NameSh3 domain YSC-like 1
SynonymsYSC84, Ray
MMRRC Submission 043066-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R5505 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location30911668-30960162 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30942073 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 176 (Y176N)
Ref Sequence ENSEMBL: ENSMUSP00000106504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020997] [ENSMUST00000110880]
Predicted Effect probably damaging
Transcript: ENSMUST00000020997
AA Change: Y214N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020997
Gene: ENSMUSG00000020669
AA Change: Y214N

DomainStartEndE-ValueType
Pfam:Ysc84 86 209 1.9e-42 PFAM
SH3 284 340 9.6e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110880
AA Change: Y176N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106504
Gene: ENSMUSG00000020669
AA Change: Y176N

DomainStartEndE-ValueType
Pfam:DUF500 47 172 2.9e-44 PFAM
SH3 246 302 9.6e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142693
Meta Mutation Damage Score 0.3739 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.9%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T A 5: 24,401,038 D240E probably damaging Het
Alpk3 G A 7: 81,078,561 E480K possibly damaging Het
Arhgap20 A G 9: 51,838,948 E372G probably damaging Het
Atp23 G T 10: 126,887,630 A201D probably damaging Het
Bpifb1 A G 2: 154,204,779 D73G probably benign Het
Ccdc7a A G 8: 128,980,174 S325P possibly damaging Het
Cckar A G 5: 53,703,068 Y140H probably damaging Het
Cd46 A T 1: 195,085,380 D124E possibly damaging Het
Cep290 T C 10: 100,499,186 probably null Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Eif2ak1 T C 5: 143,817,990 S34P probably benign Het
Enah T A 1: 181,906,453 probably benign Het
Gad2 C G 2: 22,624,833 L108V probably benign Het
Gpr22 T C 12: 31,709,725 I133V probably damaging Het
Hdac4 T C 1: 91,975,465 T13A probably benign Het
Ighv1-4 A G 12: 114,487,437 V17A possibly damaging Het
Ints8 T A 4: 11,221,143 Q744L probably benign Het
Lrit3 C T 3: 129,791,438 V224I possibly damaging Het
Mgat4a T C 1: 37,495,954 I108V probably benign Het
Mmp9 T C 2: 164,953,608 I682T probably benign Het
Myh7b G A 2: 155,632,672 A1742T probably benign Het
Nlrp12 C T 7: 3,249,385 G52D probably damaging Het
Olfr1094 T C 2: 86,829,501 F250L possibly damaging Het
Pcnx T C 12: 81,950,153 L941P probably damaging Het
Pla2g4e T C 2: 120,244,775 R45G probably benign Het
Plcz1 C G 6: 140,016,216 G203A probably damaging Het
Poldip2 A G 11: 78,515,175 T76A probably benign Het
Prdm15 T A 16: 97,816,983 H325L possibly damaging Het
Ralyl A T 3: 13,776,920 I39F probably damaging Het
Rnf220 A C 4: 117,296,091 probably benign Het
Rnpc3 T C 3: 113,615,453 K318E probably damaging Het
Rsbn1 T A 3: 103,928,943 N432K probably damaging Het
Slc25a30 G A 14: 75,763,349 L272F probably damaging Het
Spag1 T C 15: 36,234,626 V844A probably damaging Het
Srsf5 T C 12: 80,949,083 probably benign Het
Tle2 T A 10: 81,581,740 D223E probably benign Het
Tmem192 A G 8: 64,964,246 E39G possibly damaging Het
Trpc6 T A 9: 8,626,735 L362H probably damaging Het
Tuba4a A G 1: 75,216,416 Y185H probably damaging Het
Uba6 A G 5: 86,120,546 V941A probably benign Het
Vmn2r35 A T 7: 7,786,480 Y753N probably damaging Het
Zfp941 C T 7: 140,811,917 V510I probably benign Het
Other mutations in Sh3yl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Sh3yl1 APN 12 30939564 splice site probably benign
IGL02129:Sh3yl1 APN 12 30942877 splice site probably benign
IGL02448:Sh3yl1 APN 12 30939667 missense probably damaging 0.99
IGL03181:Sh3yl1 APN 12 30941980 missense possibly damaging 0.74
IGL03381:Sh3yl1 APN 12 30926837 missense possibly damaging 0.94
R1954:Sh3yl1 UTSW 12 30922333 missense possibly damaging 0.57
R1955:Sh3yl1 UTSW 12 30922333 missense possibly damaging 0.57
R1956:Sh3yl1 UTSW 12 30942788 critical splice acceptor site probably null
R1957:Sh3yl1 UTSW 12 30942788 critical splice acceptor site probably null
R2248:Sh3yl1 UTSW 12 30942870 critical splice donor site probably null
R3430:Sh3yl1 UTSW 12 30959842 missense probably benign 0.00
R4776:Sh3yl1 UTSW 12 30940314 missense probably damaging 1.00
R6152:Sh3yl1 UTSW 12 30942035 missense probably benign 0.01
R7075:Sh3yl1 UTSW 12 30940166 intron probably null
R7765:Sh3yl1 UTSW 12 30958869 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATCATAAGATCGACTACACATG -3'
(R):5'- TCTACCTGCCAAACCTCTAGG -3'

Sequencing Primer
(F):5'- TGTGTGAATGTGCCATATTTCCC -3'
(R):5'- CCTCTAGGACATTTCTGAAGACG -3'
Posted On2016-10-05