Incidental Mutation 'R5505:Gpr22'
ID430894
Institutional Source Beutler Lab
Gene Symbol Gpr22
Ensembl Gene ENSMUSG00000044067
Gene NameG protein-coupled receptor 22
Synonyms
MMRRC Submission 043066-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5505 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location31706867-31713947 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31709725 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 133 (I133V)
Ref Sequence ENSEMBL: ENSMUSP00000056125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036862] [ENSMUST00000057783] [ENSMUST00000174480] [ENSMUST00000176710]
Predicted Effect probably benign
Transcript: ENSMUST00000036862
SMART Domains Protein: ENSMUSP00000044797
Gene: ENSMUSG00000035933

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
Pfam:COG5 35 158 3.8e-37 PFAM
Pfam:Vps51 37 120 1.8e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000057783
AA Change: I133V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000056125
Gene: ENSMUSG00000044067
AA Change: I133V

DomainStartEndE-ValueType
low complexity region 58 64 N/A INTRINSIC
Pfam:7tm_1 95 403 2.3e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000174480
AA Change: I96V

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134674
Gene: ENSMUSG00000044067
AA Change: I96V

DomainStartEndE-ValueType
low complexity region 21 27 N/A INTRINSIC
Pfam:7tm_1 58 186 3.3e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176710
AA Change: I96V

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134839
Gene: ENSMUSG00000044067
AA Change: I96V

DomainStartEndE-ValueType
low complexity region 21 27 N/A INTRINSIC
Pfam:7tm_1 58 366 1.4e-26 PFAM
Meta Mutation Damage Score 0.0678 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.9%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the G-protein coupled receptor 1 family and encodes a multi-pass membrane protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased response to aortic banding including decreased fractional shortening and decompensated heart failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T A 5: 24,401,038 D240E probably damaging Het
Alpk3 G A 7: 81,078,561 E480K possibly damaging Het
Arhgap20 A G 9: 51,838,948 E372G probably damaging Het
Atp23 G T 10: 126,887,630 A201D probably damaging Het
Bpifb1 A G 2: 154,204,779 D73G probably benign Het
Ccdc7a A G 8: 128,980,174 S325P possibly damaging Het
Cckar A G 5: 53,703,068 Y140H probably damaging Het
Cd46 A T 1: 195,085,380 D124E possibly damaging Het
Cep290 T C 10: 100,499,186 probably null Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Eif2ak1 T C 5: 143,817,990 S34P probably benign Het
Enah T A 1: 181,906,453 probably benign Het
Gad2 C G 2: 22,624,833 L108V probably benign Het
Hdac4 T C 1: 91,975,465 T13A probably benign Het
Ighv1-4 A G 12: 114,487,437 V17A possibly damaging Het
Ints8 T A 4: 11,221,143 Q744L probably benign Het
Lrit3 C T 3: 129,791,438 V224I possibly damaging Het
Mgat4a T C 1: 37,495,954 I108V probably benign Het
Mmp9 T C 2: 164,953,608 I682T probably benign Het
Myh7b G A 2: 155,632,672 A1742T probably benign Het
Nlrp12 C T 7: 3,249,385 G52D probably damaging Het
Olfr1094 T C 2: 86,829,501 F250L possibly damaging Het
Pcnx T C 12: 81,950,153 L941P probably damaging Het
Pla2g4e T C 2: 120,244,775 R45G probably benign Het
Plcz1 C G 6: 140,016,216 G203A probably damaging Het
Poldip2 A G 11: 78,515,175 T76A probably benign Het
Prdm15 T A 16: 97,816,983 H325L possibly damaging Het
Ralyl A T 3: 13,776,920 I39F probably damaging Het
Rnf220 A C 4: 117,296,091 probably benign Het
Rnpc3 T C 3: 113,615,453 K318E probably damaging Het
Rsbn1 T A 3: 103,928,943 N432K probably damaging Het
Sh3yl1 T A 12: 30,942,073 Y176N probably damaging Het
Slc25a30 G A 14: 75,763,349 L272F probably damaging Het
Spag1 T C 15: 36,234,626 V844A probably damaging Het
Srsf5 T C 12: 80,949,083 probably benign Het
Tle2 T A 10: 81,581,740 D223E probably benign Het
Tmem192 A G 8: 64,964,246 E39G possibly damaging Het
Trpc6 T A 9: 8,626,735 L362H probably damaging Het
Tuba4a A G 1: 75,216,416 Y185H probably damaging Het
Uba6 A G 5: 86,120,546 V941A probably benign Het
Vmn2r35 A T 7: 7,786,480 Y753N probably damaging Het
Zfp941 C T 7: 140,811,917 V510I probably benign Het
Other mutations in Gpr22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Gpr22 APN 12 31708710 unclassified probably benign
IGL01521:Gpr22 APN 12 31708710 unclassified probably benign
IGL01533:Gpr22 APN 12 31708710 unclassified probably benign
IGL01585:Gpr22 APN 12 31709337 missense probably benign 0.23
IGL01601:Gpr22 APN 12 31710045 splice site probably benign
IGL01608:Gpr22 APN 12 31708780 nonsense probably null
IGL02307:Gpr22 APN 12 31708740 missense possibly damaging 0.95
IGL02440:Gpr22 APN 12 31709140 missense probably damaging 0.99
IGL02863:Gpr22 APN 12 31710007 missense probably benign 0.36
IGL03163:Gpr22 APN 12 31709172 missense possibly damaging 0.68
R0078:Gpr22 UTSW 12 31711641 missense probably benign
R0358:Gpr22 UTSW 12 31709982 missense probably benign 0.03
R0395:Gpr22 UTSW 12 31709462 missense possibly damaging 0.48
R0452:Gpr22 UTSW 12 31708794 missense possibly damaging 0.69
R0729:Gpr22 UTSW 12 31709313 missense probably damaging 1.00
R1295:Gpr22 UTSW 12 31709514 missense probably benign 0.01
R1991:Gpr22 UTSW 12 31709203 missense probably benign
R4201:Gpr22 UTSW 12 31708913 nonsense probably null
R5203:Gpr22 UTSW 12 31709788 missense probably damaging 1.00
R5541:Gpr22 UTSW 12 31709349 missense probably damaging 0.97
R6218:Gpr22 UTSW 12 31711617 nonsense probably null
R6844:Gpr22 UTSW 12 31709952 missense probably benign
R7448:Gpr22 UTSW 12 31709515 missense probably benign 0.06
R7956:Gpr22 UTSW 12 31709220 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- GCTCTGCCCATTGTCAGAATTC -3'
(R):5'- TGACATTGATGACATCGACACC -3'

Sequencing Primer
(F):5'- CCCATTGTCAGAATTCTGTTTGCAGG -3'
(R):5'- GTCATACCCACTAAGCTTTCAAGTG -3'
Posted On2016-10-05