Incidental Mutation 'R5505:Srsf5'
ID430895
Institutional Source Beutler Lab
Gene Symbol Srsf5
Ensembl Gene ENSMUSG00000021134
Gene Nameserine/arginine-rich splicing factor 5
SynonymsSfrs5
MMRRC Submission 043066-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.612) question?
Stock #R5505 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location80945504-80950507 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 80949083 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094693] [ENSMUST00000095572] [ENSMUST00000110351] [ENSMUST00000110352] [ENSMUST00000110354] [ENSMUST00000110356] [ENSMUST00000138434] [ENSMUST00000218162]
Predicted Effect probably benign
Transcript: ENSMUST00000094693
SMART Domains Protein: ENSMUSP00000131323
Gene: ENSMUSG00000021134

DomainStartEndE-ValueType
RRM 5 70 4.56e-18 SMART
low complexity region 73 105 N/A INTRINSIC
RRM 109 177 5.58e-13 SMART
low complexity region 180 230 N/A INTRINSIC
low complexity region 235 267 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095572
SMART Domains Protein: ENSMUSP00000093229
Gene: ENSMUSG00000021135

DomainStartEndE-ValueType
Pfam:SBF 32 217 3.3e-47 PFAM
transmembrane domain 222 244 N/A INTRINSIC
transmembrane domain 282 304 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110351
SMART Domains Protein: ENSMUSP00000105980
Gene: ENSMUSG00000021134

DomainStartEndE-ValueType
RRM 5 70 4.56e-18 SMART
low complexity region 73 105 N/A INTRINSIC
RRM 109 177 5.58e-13 SMART
low complexity region 180 231 N/A INTRINSIC
low complexity region 236 268 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110352
SMART Domains Protein: ENSMUSP00000105981
Gene: ENSMUSG00000021134

DomainStartEndE-ValueType
RRM 5 70 4.56e-18 SMART
low complexity region 73 105 N/A INTRINSIC
RRM 109 177 5.58e-13 SMART
low complexity region 180 230 N/A INTRINSIC
low complexity region 235 267 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110354
SMART Domains Protein: ENSMUSP00000105983
Gene: ENSMUSG00000021134

DomainStartEndE-ValueType
RRM 5 70 4.56e-18 SMART
low complexity region 73 105 N/A INTRINSIC
RRM 109 177 5.58e-13 SMART
low complexity region 180 231 N/A INTRINSIC
low complexity region 236 268 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110356
SMART Domains Protein: ENSMUSP00000105985
Gene: ENSMUSG00000021134

DomainStartEndE-ValueType
RRM 5 70 4.56e-18 SMART
low complexity region 73 105 N/A INTRINSIC
RRM 109 177 5.58e-13 SMART
low complexity region 180 230 N/A INTRINSIC
low complexity region 235 267 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133783
Predicted Effect probably benign
Transcript: ENSMUST00000138434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151968
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153056
Predicted Effect probably benign
Transcript: ENSMUST00000218162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219062
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.9%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T A 5: 24,401,038 D240E probably damaging Het
Alpk3 G A 7: 81,078,561 E480K possibly damaging Het
Arhgap20 A G 9: 51,838,948 E372G probably damaging Het
Atp23 G T 10: 126,887,630 A201D probably damaging Het
Bpifb1 A G 2: 154,204,779 D73G probably benign Het
Ccdc7a A G 8: 128,980,174 S325P possibly damaging Het
Cckar A G 5: 53,703,068 Y140H probably damaging Het
Cd46 A T 1: 195,085,380 D124E possibly damaging Het
Cep290 T C 10: 100,499,186 probably null Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Eif2ak1 T C 5: 143,817,990 S34P probably benign Het
Enah T A 1: 181,906,453 probably benign Het
Gad2 C G 2: 22,624,833 L108V probably benign Het
Gpr22 T C 12: 31,709,725 I133V probably damaging Het
Hdac4 T C 1: 91,975,465 T13A probably benign Het
Ighv1-4 A G 12: 114,487,437 V17A possibly damaging Het
Ints8 T A 4: 11,221,143 Q744L probably benign Het
Lrit3 C T 3: 129,791,438 V224I possibly damaging Het
Mgat4a T C 1: 37,495,954 I108V probably benign Het
Mmp9 T C 2: 164,953,608 I682T probably benign Het
Myh7b G A 2: 155,632,672 A1742T probably benign Het
Nlrp12 C T 7: 3,249,385 G52D probably damaging Het
Olfr1094 T C 2: 86,829,501 F250L possibly damaging Het
Pcnx T C 12: 81,950,153 L941P probably damaging Het
Pla2g4e T C 2: 120,244,775 R45G probably benign Het
Plcz1 C G 6: 140,016,216 G203A probably damaging Het
Poldip2 A G 11: 78,515,175 T76A probably benign Het
Prdm15 T A 16: 97,816,983 H325L possibly damaging Het
Ralyl A T 3: 13,776,920 I39F probably damaging Het
Rnf220 A C 4: 117,296,091 probably benign Het
Rnpc3 T C 3: 113,615,453 K318E probably damaging Het
Rsbn1 T A 3: 103,928,943 N432K probably damaging Het
Sh3yl1 T A 12: 30,942,073 Y176N probably damaging Het
Slc25a30 G A 14: 75,763,349 L272F probably damaging Het
Spag1 T C 15: 36,234,626 V844A probably damaging Het
Tle2 T A 10: 81,581,740 D223E probably benign Het
Tmem192 A G 8: 64,964,246 E39G possibly damaging Het
Trpc6 T A 9: 8,626,735 L362H probably damaging Het
Tuba4a A G 1: 75,216,416 Y185H probably damaging Het
Uba6 A G 5: 86,120,546 V941A probably benign Het
Vmn2r35 A T 7: 7,786,480 Y753N probably damaging Het
Zfp941 C T 7: 140,811,917 V510I probably benign Het
Other mutations in Srsf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Srsf5 APN 12 80947834 missense probably damaging 1.00
R0344:Srsf5 UTSW 12 80947524 missense probably benign 0.00
R0827:Srsf5 UTSW 12 80949540 missense probably damaging 1.00
R1552:Srsf5 UTSW 12 80949745 unclassified probably benign
R2519:Srsf5 UTSW 12 80949096 missense probably damaging 0.99
R4926:Srsf5 UTSW 12 80947301 utr 3 prime probably benign
R5786:Srsf5 UTSW 12 80949537 missense possibly damaging 0.48
R7810:Srsf5 UTSW 12 80949946 missense unknown
Predicted Primers PCR Primer
(F):5'- GGGGCACAAAATAACTGGTGTC -3'
(R):5'- AGGTGCCTATTATCAACAGTCCC -3'

Sequencing Primer
(F):5'- AAAAATTGGAATGCCCTCTAGC -3'
(R):5'- ATCAACAGTCCCTTGTGATAGTC -3'
Posted On2016-10-05