Incidental Mutation 'R5505:Slc25a30'
ID430899
Institutional Source Beutler Lab
Gene Symbol Slc25a30
Ensembl Gene ENSMUSG00000022003
Gene Namesolute carrier family 25, member 30
Synonyms4933433D23Rik, KMCP1
MMRRC Submission 043066-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5505 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location75760117-75787037 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 75763349 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 272 (L272F)
Ref Sequence ENSEMBL: ENSMUSP00000022580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022580]
Predicted Effect probably damaging
Transcript: ENSMUST00000022580
AA Change: L272F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022580
Gene: ENSMUSG00000022003
AA Change: L272F

DomainStartEndE-ValueType
Pfam:Mito_carr 2 100 1.2e-22 PFAM
Pfam:Mito_carr 102 194 3.2e-22 PFAM
Pfam:Mito_carr 197 290 7.4e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226574
Meta Mutation Damage Score 0.6108 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.9%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Although the outer mitochondrial membrane is permeable to many small metabolites, transport of solutes across the inner mitochondrial membrane is achieved by members of the mitochondrial carrier protein family, such as SLC25A30 (Haguenauer et al., 2005 [PubMed 15809292]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 T A 5: 24,401,038 D240E probably damaging Het
Alpk3 G A 7: 81,078,561 E480K possibly damaging Het
Arhgap20 A G 9: 51,838,948 E372G probably damaging Het
Atp23 G T 10: 126,887,630 A201D probably damaging Het
Bpifb1 A G 2: 154,204,779 D73G probably benign Het
Ccdc7a A G 8: 128,980,174 S325P possibly damaging Het
Cckar A G 5: 53,703,068 Y140H probably damaging Het
Cd46 A T 1: 195,085,380 D124E possibly damaging Het
Cep290 T C 10: 100,499,186 probably null Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Eif2ak1 T C 5: 143,817,990 S34P probably benign Het
Enah T A 1: 181,906,453 probably benign Het
Gad2 C G 2: 22,624,833 L108V probably benign Het
Gpr22 T C 12: 31,709,725 I133V probably damaging Het
Hdac4 T C 1: 91,975,465 T13A probably benign Het
Ighv1-4 A G 12: 114,487,437 V17A possibly damaging Het
Ints8 T A 4: 11,221,143 Q744L probably benign Het
Lrit3 C T 3: 129,791,438 V224I possibly damaging Het
Mgat4a T C 1: 37,495,954 I108V probably benign Het
Mmp9 T C 2: 164,953,608 I682T probably benign Het
Myh7b G A 2: 155,632,672 A1742T probably benign Het
Nlrp12 C T 7: 3,249,385 G52D probably damaging Het
Olfr1094 T C 2: 86,829,501 F250L possibly damaging Het
Pcnx T C 12: 81,950,153 L941P probably damaging Het
Pla2g4e T C 2: 120,244,775 R45G probably benign Het
Plcz1 C G 6: 140,016,216 G203A probably damaging Het
Poldip2 A G 11: 78,515,175 T76A probably benign Het
Prdm15 T A 16: 97,816,983 H325L possibly damaging Het
Ralyl A T 3: 13,776,920 I39F probably damaging Het
Rnf220 A C 4: 117,296,091 probably benign Het
Rnpc3 T C 3: 113,615,453 K318E probably damaging Het
Rsbn1 T A 3: 103,928,943 N432K probably damaging Het
Sh3yl1 T A 12: 30,942,073 Y176N probably damaging Het
Spag1 T C 15: 36,234,626 V844A probably damaging Het
Srsf5 T C 12: 80,949,083 probably benign Het
Tle2 T A 10: 81,581,740 D223E probably benign Het
Tmem192 A G 8: 64,964,246 E39G possibly damaging Het
Trpc6 T A 9: 8,626,735 L362H probably damaging Het
Tuba4a A G 1: 75,216,416 Y185H probably damaging Het
Uba6 A G 5: 86,120,546 V941A probably benign Het
Vmn2r35 A T 7: 7,786,480 Y753N probably damaging Het
Zfp941 C T 7: 140,811,917 V510I probably benign Het
Other mutations in Slc25a30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Slc25a30 APN 14 75766925 missense possibly damaging 0.90
IGL00922:Slc25a30 APN 14 75769598 missense probably damaging 1.00
IGL01310:Slc25a30 APN 14 75769597 missense probably damaging 1.00
IGL02135:Slc25a30 APN 14 75766995 missense probably benign 0.00
IGL02573:Slc25a30 APN 14 75769668 splice site probably benign
R0044:Slc25a30 UTSW 14 75769649 missense probably benign 0.37
R0330:Slc25a30 UTSW 14 75762672 nonsense probably null
R1743:Slc25a30 UTSW 14 75775083 missense probably benign 0.01
R1744:Slc25a30 UTSW 14 75763330 missense probably damaging 1.00
R1950:Slc25a30 UTSW 14 75769567 missense possibly damaging 0.55
R2122:Slc25a30 UTSW 14 75770218 missense possibly damaging 0.90
R2880:Slc25a30 UTSW 14 75770211 missense probably benign 0.05
R4791:Slc25a30 UTSW 14 75763366 missense probably benign 0.00
R5158:Slc25a30 UTSW 14 75771516 missense probably damaging 1.00
R5198:Slc25a30 UTSW 14 75769616 missense probably benign 0.03
R6485:Slc25a30 UTSW 14 75775007 missense probably damaging 1.00
X0027:Slc25a30 UTSW 14 75766973 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- CTCGGTGTTGAATGAGGAGACC -3'
(R):5'- TAACTGGAAAATGGGGCTTGTC -3'

Sequencing Primer
(F):5'- ACCTCACAGGGCCTAGAGATG -3'
(R):5'- AAATGCCTTAGATCTCGTGGAGGC -3'
Posted On2016-10-05