Incidental Mutation 'R5506:Capn3'
ID430905
Institutional Source Beutler Lab
Gene Symbol Capn3
Ensembl Gene ENSMUSG00000079110
Gene Namecalpain 3
SynonymsCapa-3, Capa3, Lp82, p94
MMRRC Submission 043067-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R5506 (G1)
Quality Score181
Status Validated
Chromosome2
Chromosomal Location120456019-120504913 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 120502420 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 612 (V612F)
Ref Sequence ENSEMBL: ENSMUSP00000106344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028748] [ENSMUST00000028749] [ENSMUST00000055241] [ENSMUST00000090028] [ENSMUST00000110716] [ENSMUST00000110719] [ENSMUST00000110721]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028748
AA Change: V564F

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028748
Gene: ENSMUSG00000079110
AA Change: V564F

DomainStartEndE-ValueType
CysPc 32 357 5.98e-199 SMART
calpain_III 360 514 4.27e-90 SMART
EFh 584 612 5.53e-4 SMART
EFh 614 642 1.8e-3 SMART
EFh 679 707 4.32e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000028749
AA Change: V676F

PolyPhen 2 Score 0.789 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028749
Gene: ENSMUSG00000079110
AA Change: V676F

DomainStartEndE-ValueType
CysPc 56 425 2.09e-212 SMART
calpain_III 428 582 4.27e-90 SMART
Pfam:Calpain_u2 583 653 1.3e-31 PFAM
EFh 696 724 5.53e-4 SMART
EFh 726 754 1.8e-3 SMART
EFh 791 819 4.32e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000055241
SMART Domains Protein: ENSMUSP00000055602
Gene: ENSMUSG00000027288

DomainStartEndE-ValueType
ZnF_C2H2 5 29 1.51e0 SMART
ZnF_C2H2 43 67 7.18e1 SMART
low complexity region 75 92 N/A INTRINSIC
low complexity region 141 152 N/A INTRINSIC
low complexity region 199 212 N/A INTRINSIC
low complexity region 466 480 N/A INTRINSIC
coiled coil region 800 823 N/A INTRINSIC
low complexity region 842 856 N/A INTRINSIC
low complexity region 1049 1062 N/A INTRINSIC
low complexity region 1312 1321 N/A INTRINSIC
low complexity region 1361 1373 N/A INTRINSIC
low complexity region 1389 1409 N/A INTRINSIC
WD40 1525 1562 9.24e-4 SMART
WD40 1565 1607 1.83e-7 SMART
PQQ 1587 1618 3.42e2 SMART
WD40 1651 1691 3.45e-1 SMART
PQQ 1671 1702 9.14e1 SMART
WD40 1694 1731 2.12e-3 SMART
PQQ 1711 1742 6.42e0 SMART
WD40 1734 1771 6e-3 SMART
PQQ 1751 1782 5.7e2 SMART
WD40 1774 1811 3.58e-1 SMART
ZnF_C2H2 1818 1843 5.34e-1 SMART
ZnF_C2H2 1851 1879 1.31e2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000090028
AA Change: V564F

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000087482
Gene: ENSMUSG00000079110
AA Change: V564F

DomainStartEndE-ValueType
CysPc 32 357 5.98e-199 SMART
calpain_III 360 514 4.27e-90 SMART
low complexity region 585 599 N/A INTRINSIC
EFh 612 640 5.53e-4 SMART
EFh 642 670 1.8e-3 SMART
EFh 707 735 4.32e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110716
AA Change: V612F

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106344
Gene: ENSMUSG00000079110
AA Change: V612F

DomainStartEndE-ValueType
CysPc 32 405 8.38e-203 SMART
calpain_III 408 562 4.27e-90 SMART
EFh 632 660 5.53e-4 SMART
EFh 662 690 1.8e-3 SMART
EFh 727 755 4.32e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110719
AA Change: V612F

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000106347
Gene: ENSMUSG00000079110
AA Change: V612F

DomainStartEndE-ValueType
CysPc 32 405 8.38e-203 SMART
calpain_III 408 562 4.27e-90 SMART
low complexity region 633 647 N/A INTRINSIC
EFh 660 688 5.53e-4 SMART
EFh 690 718 1.8e-3 SMART
EFh 755 783 4.32e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110721
AA Change: V584F

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106349
Gene: ENSMUSG00000079110
AA Change: V584F

DomainStartEndE-ValueType
CysPc 56 377 1.13e-208 SMART
calpain_III 380 534 4.27e-90 SMART
EFh 604 632 5.53e-4 SMART
EFh 634 662 1.8e-3 SMART
EFh 699 727 4.32e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139336
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141181
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151342
Meta Mutation Damage Score 0.3217 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calpain, a heterodimer consisting of a large and a small subunit, is a major intracellular protease, although its function has not been well established. This gene encodes a muscle-specific member of the calpain large subunit family that specifically binds to titin. Mutations in this gene are associated with limb-girdle muscular dystrophies type 2A. Alternate promoters and alternative splicing result in multiple transcript variants encoding different isoforms and some variants are ubiquitously expressed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in muscle dystrophy. The psoas, soleus, and deltoid muscles are the most severely affected. The mutant allele appears to be preferentially transmitted resulting in ratio distortion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,067,947 G966W probably damaging Het
3110002H16Rik A G 18: 12,188,956 probably benign Het
A930009A15Rik G T 10: 115,578,362 probably null Het
Cant1 G T 11: 118,411,442 H16Q probably benign Het
Cep112 A T 11: 108,664,603 E141D probably damaging Het
Cept1 A G 3: 106,531,248 V173A probably benign Het
CN725425 A G 15: 91,235,826 D50G possibly damaging Het
Cubn A T 2: 13,491,695 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dpp8 A G 9: 65,078,109 probably null Het
Ecm1 G A 3: 95,735,857 T377I probably benign Het
Exosc8 A G 3: 54,731,179 probably benign Het
Fam129b G A 2: 32,920,982 V335M probably damaging Het
Fam71f1 G A 6: 29,319,298 E34K probably damaging Het
Fasn C T 11: 120,809,510 D2165N probably benign Het
Gab2 A G 7: 97,303,113 E571G probably damaging Het
Galnt5 C A 2: 57,999,625 H412Q probably benign Het
Galr1 T A 18: 82,405,864 Y96F possibly damaging Het
Gm8882 T C 6: 132,361,856 N133S unknown Het
Gnl2 C A 4: 125,055,365 probably benign Het
H2afx T C 9: 44,335,105 V115A probably benign Het
Heatr9 T C 11: 83,514,766 N317S possibly damaging Het
Hist1h2an A C 13: 21,786,911 I103S probably damaging Het
Kndc1 A G 7: 139,927,891 Y1254C probably damaging Het
Lrp6 A T 6: 134,459,296 D1302E probably benign Het
Mc2r A T 18: 68,407,948 Y91* probably null Het
Meis1 T G 11: 18,941,747 D267A possibly damaging Het
Mki67 T C 7: 135,699,981 K1108R possibly damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myh3 T G 11: 67,084,089 D219E probably damaging Het
Olfr1511 T C 14: 52,390,627 I49V probably damaging Het
Olfr857 T C 9: 19,713,274 L149P possibly damaging Het
Pi4ka A G 16: 17,293,953 C1553R probably damaging Het
Plekhb1 C A 7: 100,644,943 probably null Het
Polr3d A T 14: 70,440,759 D165E possibly damaging Het
Psmb1 A G 17: 15,490,216 Y24H probably damaging Het
Rab11fip5 A G 6: 85,374,137 L131P probably damaging Het
Raph1 A T 1: 60,493,498 probably benign Het
Scgb2b27 T G 7: 34,012,059 probably benign Het
Serpina10 T C 12: 103,626,661 D264G probably damaging Het
Sftpb A G 6: 72,304,667 T15A possibly damaging Het
Slc20a1 T C 2: 129,210,819 F674L probably benign Het
Syne2 A T 12: 75,938,721 N1648Y probably benign Het
Thsd7a G T 6: 12,332,017 N1265K possibly damaging Het
Trem2 T C 17: 48,351,774 L189P probably benign Het
Washc4 A T 10: 83,581,337 R865S probably damaging Het
Zfp536 A G 7: 37,568,792 S400P probably damaging Het
Other mutations in Capn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Capn3 APN 2 120486482 intron probably benign
IGL00976:Capn3 APN 2 120491901 missense possibly damaging 0.81
IGL01538:Capn3 APN 2 120502186 splice site probably null
IGL01564:Capn3 APN 2 120480708 missense probably damaging 1.00
IGL02527:Capn3 APN 2 120504485 missense probably damaging 0.99
IGL02605:Capn3 APN 2 120496037 missense probably damaging 0.98
IGL02678:Capn3 APN 2 120502998 missense probably damaging 1.00
IGL02899:Capn3 APN 2 120491901 missense possibly damaging 0.81
IGL03255:Capn3 APN 2 120489708 missense probably damaging 1.00
R0053:Capn3 UTSW 2 120491837 missense possibly damaging 0.95
R0053:Capn3 UTSW 2 120491837 missense possibly damaging 0.95
R0096:Capn3 UTSW 2 120502529 missense possibly damaging 0.94
R0096:Capn3 UTSW 2 120502529 missense possibly damaging 0.94
R0276:Capn3 UTSW 2 120488065 splice site probably benign
R0601:Capn3 UTSW 2 120502596 splice site probably null
R0714:Capn3 UTSW 2 120491880 missense probably benign 0.32
R1217:Capn3 UTSW 2 120486421 nonsense probably null
R1530:Capn3 UTSW 2 120482208 missense probably damaging 1.00
R1566:Capn3 UTSW 2 120502993 missense possibly damaging 0.72
R1745:Capn3 UTSW 2 120489689 missense possibly damaging 0.87
R1748:Capn3 UTSW 2 120497013 missense probably benign 0.10
R1861:Capn3 UTSW 2 120486482 intron probably benign
R1960:Capn3 UTSW 2 120463940 missense probably benign 0.00
R1971:Capn3 UTSW 2 120480747 missense possibly damaging 0.95
R1994:Capn3 UTSW 2 120495937 missense probably damaging 1.00
R2043:Capn3 UTSW 2 120491901 missense possibly damaging 0.81
R2254:Capn3 UTSW 2 120501251 missense probably benign 0.01
R2255:Capn3 UTSW 2 120501251 missense probably benign 0.01
R3738:Capn3 UTSW 2 120485287 missense possibly damaging 0.85
R3824:Capn3 UTSW 2 120484483 splice site probably benign
R4796:Capn3 UTSW 2 120502998 missense probably damaging 1.00
R5073:Capn3 UTSW 2 120491820 missense probably damaging 1.00
R5116:Capn3 UTSW 2 120485292 missense probably benign 0.00
R5152:Capn3 UTSW 2 120501330 intron probably benign
R5420:Capn3 UTSW 2 120495296 intron probably benign
R5478:Capn3 UTSW 2 120464185 splice site probably null
R5664:Capn3 UTSW 2 120477025 missense probably benign 0.04
R5733:Capn3 UTSW 2 120484594 nonsense probably null
R6212:Capn3 UTSW 2 120477186 missense probably benign 0.17
R7176:Capn3 UTSW 2 120504492 missense possibly damaging 0.46
R7219:Capn3 UTSW 2 120503454 missense probably damaging 0.99
R7365:Capn3 UTSW 2 120494814 missense probably damaging 0.98
R7819:Capn3 UTSW 2 120464165 missense probably benign 0.05
R8052:Capn3 UTSW 2 120486386 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTCATTTGATGTGGGAGAACC -3'
(R):5'- TGGACACCCTTAACTGTTCC -3'

Sequencing Primer
(F):5'- CCAGAGAATGTGTGATGCATC -3'
(R):5'- CTCTGGGCAGATGGAAGGATACATC -3'
Posted On2016-10-05