Incidental Mutation 'R5506:Cept1'
List |< first << previous [record 7 of 48] next >> last >|
ID430908
Institutional Source Beutler Lab
Gene Symbol Cept1
Ensembl Gene ENSMUSG00000040774
Gene Namecholine/ethanolaminephosphotransferase 1
Synonyms9930118K05Rik
MMRRC Submission 043067-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R5506 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location106502260-106547802 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106531248 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 173 (V173A)
Ref Sequence ENSEMBL: ENSMUSP00000112509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039153] [ENSMUST00000068301] [ENSMUST00000121231] [ENSMUST00000137530] [ENSMUST00000148269] [ENSMUST00000192438]
Predicted Effect probably benign
Transcript: ENSMUST00000039153
AA Change: V173A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000037277
Gene: ENSMUSG00000040774
AA Change: V173A

DomainStartEndE-ValueType
Pfam:CDP-OH_P_transf 81 229 6.4e-23 PFAM
transmembrane domain 249 271 N/A INTRINSIC
transmembrane domain 281 303 N/A INTRINSIC
transmembrane domain 316 338 N/A INTRINSIC
transmembrane domain 370 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068301
AA Change: V173A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000065743
Gene: ENSMUSG00000040774
AA Change: V173A

DomainStartEndE-ValueType
Pfam:CDP-OH_P_transf 81 328 3.2e-21 PFAM
transmembrane domain 370 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121231
AA Change: V173A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000112509
Gene: ENSMUSG00000040774
AA Change: V173A

DomainStartEndE-ValueType
Pfam:CDP-OH_P_transf 83 158 7.4e-18 PFAM
transmembrane domain 181 203 N/A INTRINSIC
transmembrane domain 213 235 N/A INTRINSIC
transmembrane domain 248 270 N/A INTRINSIC
transmembrane domain 285 304 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
transmembrane domain 370 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137530
SMART Domains Protein: ENSMUSP00000115898
Gene: ENSMUSG00000040774

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148269
SMART Domains Protein: ENSMUSP00000118343
Gene: ENSMUSG00000040774

DomainStartEndE-ValueType
Pfam:CDP-OH_P_transf 81 178 8.8e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192438
SMART Domains Protein: ENSMUSP00000142097
Gene: ENSMUSG00000040774

DomainStartEndE-ValueType
Pfam:CDP-OH_P_transf 81 215 2.3e-20 PFAM
transmembrane domain 227 246 N/A INTRINSIC
Meta Mutation Damage Score 0.0671 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene codes for a choline/ethanolaminephosphotransferase, which functions in the synthesis of choline- or ethanolamine- containing phospholipids. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Conditional homozygous knockout in skeletal muscle leads to improved glucose tolerance, increased insulin sensitivity and muscle weakness in mice fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,067,947 G966W probably damaging Het
3110002H16Rik A G 18: 12,188,956 probably benign Het
A930009A15Rik G T 10: 115,578,362 probably null Het
Cant1 G T 11: 118,411,442 H16Q probably benign Het
Capn3 G T 2: 120,502,420 V612F probably damaging Het
Cep112 A T 11: 108,664,603 E141D probably damaging Het
CN725425 A G 15: 91,235,826 D50G possibly damaging Het
Cubn A T 2: 13,491,695 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dpp8 A G 9: 65,078,109 probably null Het
Ecm1 G A 3: 95,735,857 T377I probably benign Het
Exosc8 A G 3: 54,731,179 probably benign Het
Fam129b G A 2: 32,920,982 V335M probably damaging Het
Fam71f1 G A 6: 29,319,298 E34K probably damaging Het
Fasn C T 11: 120,809,510 D2165N probably benign Het
Gab2 A G 7: 97,303,113 E571G probably damaging Het
Galnt5 C A 2: 57,999,625 H412Q probably benign Het
Galr1 T A 18: 82,405,864 Y96F possibly damaging Het
Gm8882 T C 6: 132,361,856 N133S unknown Het
Gnl2 C A 4: 125,055,365 probably benign Het
H2afx T C 9: 44,335,105 V115A probably benign Het
Heatr9 T C 11: 83,514,766 N317S possibly damaging Het
Hist1h2an A C 13: 21,786,911 I103S probably damaging Het
Kndc1 A G 7: 139,927,891 Y1254C probably damaging Het
Lrp6 A T 6: 134,459,296 D1302E probably benign Het
Mc2r A T 18: 68,407,948 Y91* probably null Het
Meis1 T G 11: 18,941,747 D267A possibly damaging Het
Mki67 T C 7: 135,699,981 K1108R possibly damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myh3 T G 11: 67,084,089 D219E probably damaging Het
Olfr1511 T C 14: 52,390,627 I49V probably damaging Het
Olfr857 T C 9: 19,713,274 L149P possibly damaging Het
Pi4ka A G 16: 17,293,953 C1553R probably damaging Het
Plekhb1 C A 7: 100,644,943 probably null Het
Polr3d A T 14: 70,440,759 D165E possibly damaging Het
Psmb1 A G 17: 15,490,216 Y24H probably damaging Het
Rab11fip5 A G 6: 85,374,137 L131P probably damaging Het
Raph1 A T 1: 60,493,498 probably benign Het
Scgb2b27 T G 7: 34,012,059 probably benign Het
Serpina10 T C 12: 103,626,661 D264G probably damaging Het
Sftpb A G 6: 72,304,667 T15A possibly damaging Het
Slc20a1 T C 2: 129,210,819 F674L probably benign Het
Syne2 A T 12: 75,938,721 N1648Y probably benign Het
Thsd7a G T 6: 12,332,017 N1265K possibly damaging Het
Trem2 T C 17: 48,351,774 L189P probably benign Het
Washc4 A T 10: 83,581,337 R865S probably damaging Het
Zfp536 A G 7: 37,568,792 S400P probably damaging Het
Other mutations in Cept1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Cept1 APN 3 106505803 missense possibly damaging 0.95
IGL01860:Cept1 APN 3 106531128 intron probably benign
IGL02053:Cept1 APN 3 106533396 missense probably damaging 1.00
IGL02351:Cept1 APN 3 106539188 critical splice donor site probably null
IGL02358:Cept1 APN 3 106539188 critical splice donor site probably null
IGL02568:Cept1 APN 3 106503719 missense probably benign 0.03
IGL02960:Cept1 APN 3 106539396 nonsense probably null
IGL03019:Cept1 APN 3 106504641 missense probably damaging 1.00
IGL03182:Cept1 APN 3 106504550 missense probably damaging 1.00
IGL03401:Cept1 APN 3 106533390 missense probably damaging 1.00
R2128:Cept1 UTSW 3 106512879 missense probably damaging 1.00
R2928:Cept1 UTSW 3 106531152 missense probably benign 0.07
R3688:Cept1 UTSW 3 106520015 missense probably benign 0.00
R4762:Cept1 UTSW 3 106539361 nonsense probably null
R4861:Cept1 UTSW 3 106505732 missense probably damaging 0.97
R4861:Cept1 UTSW 3 106505732 missense probably damaging 0.97
R4890:Cept1 UTSW 3 106505807 missense probably damaging 1.00
R5999:Cept1 UTSW 3 106533443 missense probably damaging 1.00
R6106:Cept1 UTSW 3 106503676 missense probably benign 0.00
R6478:Cept1 UTSW 3 106533445 nonsense probably null
R6560:Cept1 UTSW 3 106505278 missense possibly damaging 0.84
R6858:Cept1 UTSW 3 106512879 splice site probably null
R7372:Cept1 UTSW 3 106503740 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- GCACTTCATTTCCAAAGGAATACAG -3'
(R):5'- ACTTTGCTTCAGCTAAATGACC -3'

Sequencing Primer
(F):5'- TTCATTTCCAAAGGAATACAGAGAGG -3'
(R):5'- TCTGTATCTCATCTAAGGTGA -3'
Posted On2016-10-05