Incidental Mutation 'R5506:Sftpb'
List |< first << previous [record 42 of 48] next >> last >|
ID430916
Institutional Source Beutler Lab
Gene Symbol Sftpb
Ensembl Gene ENSMUSG00000056370
Gene Namesurfactant associated protein B
SynonymsSftp-3, SP-B, SF-B, Sftp3
MMRRC Submission 043067-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.461) question?
Stock #R5506 (G1)
Quality Score151
Status Validated
Chromosome6
Chromosomal Location72304610-72314371 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72304667 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 15 (T15A)
Ref Sequence ENSEMBL: ENSMUSP00000138485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070437] [ENSMUST00000182014] [ENSMUST00000183018] [ENSMUST00000183278]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070437
AA Change: T15A

PolyPhen 2 Score 0.459 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000066805
Gene: ENSMUSG00000056370
AA Change: T15A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SAPA 27 60 1.27e-16 SMART
SapB 66 142 4.21e-21 SMART
low complexity region 159 182 N/A INTRINSIC
SapB 197 267 7.13e-10 SMART
SapB 292 361 2.5e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000182014
AA Change: T15A

PolyPhen 2 Score 0.459 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000138204
Gene: ENSMUSG00000056370
AA Change: T15A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SAPA 27 60 1.27e-16 SMART
SapB 66 142 4.21e-21 SMART
low complexity region 159 182 N/A INTRINSIC
PDB:1DFW|A 192 216 1e-7 PDB
Blast:SapB 197 234 3e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182765
SMART Domains Protein: ENSMUSP00000138298
Gene: ENSMUSG00000056370

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
Blast:SapB 43 91 1e-20 BLAST
PDB:2JOU|A 45 92 1e-7 PDB
SapB 116 185 2.5e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000183018
AA Change: T15A

PolyPhen 2 Score 0.459 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000138695
Gene: ENSMUSG00000056370
AA Change: T15A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SAPA 27 60 1.27e-16 SMART
SapB 66 142 4.21e-21 SMART
low complexity region 159 182 N/A INTRINSIC
Blast:SapB 197 245 3e-19 BLAST
PDB:2JOU|A 199 246 3e-7 PDB
SapB 270 339 2.5e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000183278
AA Change: T15A

PolyPhen 2 Score 0.459 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000138485
Gene: ENSMUSG00000056370
AA Change: T15A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SAPA 27 60 1.27e-16 SMART
SapB 66 142 4.21e-21 SMART
low complexity region 159 182 N/A INTRINSIC
PDB:1DFW|A 192 216 1e-7 PDB
Blast:SapB 197 234 3e-15 BLAST
Meta Mutation Damage Score 0.0972 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the pulmonary-associated surfactant protein B (SPB), an amphipathic surfactant protein essential for lung function and homeostasis after birth. Pulmonary surfactant is a surface-active lipoprotein complex composed of 90% lipids and 10% proteins which include plasma proteins and apolipoproteins SPA, SPB, SPC and SPD. The surfactant is secreted by the alveolar cells of the lung and maintains the stability of pulmonary tissue by reducing the surface tension of fluids that coat the lung. The SPB enhances the rate of spreading and increases the stability of surfactant monolayers in vitro. Multiple mutations in this gene have been identified, which cause pulmonary surfactant metabolism dysfunction type 1, also called pulmonary alveolar proteinosis due to surfactant protein B deficiency, and are associated with fatal respiratory distress in the neonatal period. Alternatively spliced transcript variants encoding the same protein have been identified.[provided by RefSeq, Feb 2010]
PHENOTYPE: Inactivation of this gene results in respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,067,947 G966W probably damaging Het
3110002H16Rik A G 18: 12,188,956 probably benign Het
A930009A15Rik G T 10: 115,578,362 probably null Het
Cant1 G T 11: 118,411,442 H16Q probably benign Het
Capn3 G T 2: 120,502,420 V612F probably damaging Het
Cep112 A T 11: 108,664,603 E141D probably damaging Het
Cept1 A G 3: 106,531,248 V173A probably benign Het
CN725425 A G 15: 91,235,826 D50G possibly damaging Het
Cubn A T 2: 13,491,695 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dpp8 A G 9: 65,078,109 probably null Het
Ecm1 G A 3: 95,735,857 T377I probably benign Het
Exosc8 A G 3: 54,731,179 probably benign Het
Fam129b G A 2: 32,920,982 V335M probably damaging Het
Fam71f1 G A 6: 29,319,298 E34K probably damaging Het
Fasn C T 11: 120,809,510 D2165N probably benign Het
Gab2 A G 7: 97,303,113 E571G probably damaging Het
Galnt5 C A 2: 57,999,625 H412Q probably benign Het
Galr1 T A 18: 82,405,864 Y96F possibly damaging Het
Gm8882 T C 6: 132,361,856 N133S unknown Het
Gnl2 C A 4: 125,055,365 probably benign Het
H2afx T C 9: 44,335,105 V115A probably benign Het
Heatr9 T C 11: 83,514,766 N317S possibly damaging Het
Hist1h2an A C 13: 21,786,911 I103S probably damaging Het
Kndc1 A G 7: 139,927,891 Y1254C probably damaging Het
Lrp6 A T 6: 134,459,296 D1302E probably benign Het
Mc2r A T 18: 68,407,948 Y91* probably null Het
Meis1 T G 11: 18,941,747 D267A possibly damaging Het
Mki67 T C 7: 135,699,981 K1108R possibly damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myh3 T G 11: 67,084,089 D219E probably damaging Het
Olfr1511 T C 14: 52,390,627 I49V probably damaging Het
Olfr857 T C 9: 19,713,274 L149P possibly damaging Het
Pi4ka A G 16: 17,293,953 C1553R probably damaging Het
Plekhb1 C A 7: 100,644,943 probably null Het
Polr3d A T 14: 70,440,759 D165E possibly damaging Het
Psmb1 A G 17: 15,490,216 Y24H probably damaging Het
Rab11fip5 A G 6: 85,374,137 L131P probably damaging Het
Raph1 A T 1: 60,493,498 probably benign Het
Scgb2b27 T G 7: 34,012,059 probably benign Het
Serpina10 T C 12: 103,626,661 D264G probably damaging Het
Slc20a1 T C 2: 129,210,819 F674L probably benign Het
Syne2 A T 12: 75,938,721 N1648Y probably benign Het
Thsd7a G T 6: 12,332,017 N1265K possibly damaging Het
Trem2 T C 17: 48,351,774 L189P probably benign Het
Washc4 A T 10: 83,581,337 R865S probably damaging Het
Zfp536 A G 7: 37,568,792 S400P probably damaging Het
Other mutations in Sftpb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Sftpb APN 6 72309862 missense probably benign 0.03
IGL02013:Sftpb APN 6 72305671 missense probably benign 0.08
R1741:Sftpb UTSW 6 72305813 missense probably benign 0.03
R2159:Sftpb UTSW 6 72309786 missense probably damaging 1.00
R5108:Sftpb UTSW 6 72304656 missense probably damaging 1.00
R5315:Sftpb UTSW 6 72306892 missense probably benign 0.31
R6415:Sftpb UTSW 6 72304649 missense probably damaging 0.96
R6622:Sftpb UTSW 6 72305655 missense possibly damaging 0.95
R7130:Sftpb UTSW 6 72305824 missense possibly damaging 0.89
R7342:Sftpb UTSW 6 72309875 missense probably benign 0.01
R7527:Sftpb UTSW 6 72305064 missense possibly damaging 0.69
R7644:Sftpb UTSW 6 72309835 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- AGGACTAGGAACCGACATCG -3'
(R):5'- TGCAAAGGAGTGGCCATTG -3'

Sequencing Primer
(F):5'- TGTCCCTGCTGAGAAGACCTG -3'
(R):5'- CAAAGGAGTGGCCATTGCTTCTG -3'
Posted On2016-10-05