Incidental Mutation 'R5506:Gm8882'
ID430918
Institutional Source Beutler Lab
Gene Symbol Gm8882
Ensembl Gene ENSMUSG00000030143
Gene Namepredicted gene 8882
Synonyms
MMRRC Submission 043067-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R5506 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location132361041-132364134 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 132361856 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 133 (N133S)
Ref Sequence ENSEMBL: ENSMUSP00000079660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080849]
Predicted Effect unknown
Transcript: ENSMUST00000080849
AA Change: N133S
SMART Domains Protein: ENSMUSP00000079660
Gene: ENSMUSG00000030143
AA Change: N133S

DomainStartEndE-ValueType
Pfam:Pro-rich 1 118 2.2e-32 PFAM
Pfam:Pro-rich 155 228 6.3e-14 PFAM
Pfam:Pro-rich 211 277 5.8e-10 PFAM
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,067,947 G966W probably damaging Het
3110002H16Rik A G 18: 12,188,956 probably benign Het
A930009A15Rik G T 10: 115,578,362 probably null Het
Cant1 G T 11: 118,411,442 H16Q probably benign Het
Capn3 G T 2: 120,502,420 V612F probably damaging Het
Cep112 A T 11: 108,664,603 E141D probably damaging Het
Cept1 A G 3: 106,531,248 V173A probably benign Het
CN725425 A G 15: 91,235,826 D50G possibly damaging Het
Cubn A T 2: 13,491,695 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dpp8 A G 9: 65,078,109 probably null Het
Ecm1 G A 3: 95,735,857 T377I probably benign Het
Exosc8 A G 3: 54,731,179 probably benign Het
Fam129b G A 2: 32,920,982 V335M probably damaging Het
Fam71f1 G A 6: 29,319,298 E34K probably damaging Het
Fasn C T 11: 120,809,510 D2165N probably benign Het
Gab2 A G 7: 97,303,113 E571G probably damaging Het
Galnt5 C A 2: 57,999,625 H412Q probably benign Het
Galr1 T A 18: 82,405,864 Y96F possibly damaging Het
Gnl2 C A 4: 125,055,365 probably benign Het
H2afx T C 9: 44,335,105 V115A probably benign Het
Heatr9 T C 11: 83,514,766 N317S possibly damaging Het
Hist1h2an A C 13: 21,786,911 I103S probably damaging Het
Kndc1 A G 7: 139,927,891 Y1254C probably damaging Het
Lrp6 A T 6: 134,459,296 D1302E probably benign Het
Mc2r A T 18: 68,407,948 Y91* probably null Het
Meis1 T G 11: 18,941,747 D267A possibly damaging Het
Mki67 T C 7: 135,699,981 K1108R possibly damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myh3 T G 11: 67,084,089 D219E probably damaging Het
Olfr1511 T C 14: 52,390,627 I49V probably damaging Het
Olfr857 T C 9: 19,713,274 L149P possibly damaging Het
Pi4ka A G 16: 17,293,953 C1553R probably damaging Het
Plekhb1 C A 7: 100,644,943 probably null Het
Polr3d A T 14: 70,440,759 D165E possibly damaging Het
Psmb1 A G 17: 15,490,216 Y24H probably damaging Het
Rab11fip5 A G 6: 85,374,137 L131P probably damaging Het
Raph1 A T 1: 60,493,498 probably benign Het
Scgb2b27 T G 7: 34,012,059 probably benign Het
Serpina10 T C 12: 103,626,661 D264G probably damaging Het
Sftpb A G 6: 72,304,667 T15A possibly damaging Het
Slc20a1 T C 2: 129,210,819 F674L probably benign Het
Syne2 A T 12: 75,938,721 N1648Y probably benign Het
Thsd7a G T 6: 12,332,017 N1265K possibly damaging Het
Trem2 T C 17: 48,351,774 L189P probably benign Het
Washc4 A T 10: 83,581,337 R865S probably damaging Het
Zfp536 A G 7: 37,568,792 S400P probably damaging Het
Other mutations in Gm8882
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02797:Gm8882 APN 6 132363045 critical splice acceptor site probably null
IGL02961:Gm8882 APN 6 132361408 missense unknown
R0334:Gm8882 UTSW 6 132364058 missense unknown
R1167:Gm8882 UTSW 6 132361590 missense unknown
R1635:Gm8882 UTSW 6 132363006 critical splice donor site probably null
R3956:Gm8882 UTSW 6 132361851 missense unknown
R4734:Gm8882 UTSW 6 132361928 missense unknown
R5275:Gm8882 UTSW 6 132361877 missense unknown
R5295:Gm8882 UTSW 6 132361877 missense unknown
R5580:Gm8882 UTSW 6 132361469 missense unknown
R5975:Gm8882 UTSW 6 132362073 missense unknown
R6503:Gm8882 UTSW 6 132361692 nonsense probably null
R8110:Gm8882 UTSW 6 132361568 missense unknown
Predicted Primers PCR Primer
(F):5'- TTGGTTTCCAGGCCTAGGAG -3'
(R):5'- TTTCCAAAACCACCTCCTGGAG -3'

Sequencing Primer
(F):5'- TTTCCAGGCCTAGGAGGTC -3'
(R):5'- GACCTCCCAGTTCTGATGAAAATG -3'
Posted On2016-10-05