Incidental Mutation 'R5506:Gab2'
List |< first << previous [record 17 of 48] next >> last >|
ID430922
Institutional Source Beutler Lab
Gene Symbol Gab2
Ensembl Gene ENSMUSG00000004508
Gene Namegrowth factor receptor bound protein 2-associated protein 2
SynonymsD130058I17Rik, p97
MMRRC Submission 043067-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.404) question?
Stock #R5506 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location97081586-97308946 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97303113 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 571 (E571G)
Ref Sequence ENSEMBL: ENSMUSP00000146200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004622] [ENSMUST00000206791]
Predicted Effect probably damaging
Transcript: ENSMUST00000004622
AA Change: E572G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000004622
Gene: ENSMUSG00000004508
AA Change: E572G

DomainStartEndE-ValueType
PH 9 121 1.07e-22 SMART
Blast:PH 268 314 4e-11 BLAST
low complexity region 348 355 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000206791
AA Change: E571G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1845 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the GRB2-associated binding protein (GAB) gene family. These proteins contain pleckstrin homology (PH) domain, and bind SHP2 tyrosine phosphatase and GRB2 adapter protein. They act as adapters for transmitting various signals in response to stimuli through cytokine and growth factor receptors, and T- and B-cell antigen receptors. The protein encoded by this gene is the principal activator of phosphatidylinositol-3 kinase in response to activation of the high affinity IgE receptor. Two alternatively spliced transcripts encoding different isoforms have been described for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in passive cutaneous and systemic anaphylaxis, Fc gamma receptor-mediated phagocytosis, and mast cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,067,947 G966W probably damaging Het
3110002H16Rik A G 18: 12,188,956 probably benign Het
A930009A15Rik G T 10: 115,578,362 probably null Het
Cant1 G T 11: 118,411,442 H16Q probably benign Het
Capn3 G T 2: 120,502,420 V612F probably damaging Het
Cep112 A T 11: 108,664,603 E141D probably damaging Het
Cept1 A G 3: 106,531,248 V173A probably benign Het
CN725425 A G 15: 91,235,826 D50G possibly damaging Het
Cubn A T 2: 13,491,695 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dpp8 A G 9: 65,078,109 probably null Het
Ecm1 G A 3: 95,735,857 T377I probably benign Het
Exosc8 A G 3: 54,731,179 probably benign Het
Fam129b G A 2: 32,920,982 V335M probably damaging Het
Fam71f1 G A 6: 29,319,298 E34K probably damaging Het
Fasn C T 11: 120,809,510 D2165N probably benign Het
Galnt5 C A 2: 57,999,625 H412Q probably benign Het
Galr1 T A 18: 82,405,864 Y96F possibly damaging Het
Gm8882 T C 6: 132,361,856 N133S unknown Het
Gnl2 C A 4: 125,055,365 probably benign Het
H2afx T C 9: 44,335,105 V115A probably benign Het
Heatr9 T C 11: 83,514,766 N317S possibly damaging Het
Hist1h2an A C 13: 21,786,911 I103S probably damaging Het
Kndc1 A G 7: 139,927,891 Y1254C probably damaging Het
Lrp6 A T 6: 134,459,296 D1302E probably benign Het
Mc2r A T 18: 68,407,948 Y91* probably null Het
Meis1 T G 11: 18,941,747 D267A possibly damaging Het
Mki67 T C 7: 135,699,981 K1108R possibly damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myh3 T G 11: 67,084,089 D219E probably damaging Het
Olfr1511 T C 14: 52,390,627 I49V probably damaging Het
Olfr857 T C 9: 19,713,274 L149P possibly damaging Het
Pi4ka A G 16: 17,293,953 C1553R probably damaging Het
Plekhb1 C A 7: 100,644,943 probably null Het
Polr3d A T 14: 70,440,759 D165E possibly damaging Het
Psmb1 A G 17: 15,490,216 Y24H probably damaging Het
Rab11fip5 A G 6: 85,374,137 L131P probably damaging Het
Raph1 A T 1: 60,493,498 probably benign Het
Scgb2b27 T G 7: 34,012,059 probably benign Het
Serpina10 T C 12: 103,626,661 D264G probably damaging Het
Sftpb A G 6: 72,304,667 T15A possibly damaging Het
Slc20a1 T C 2: 129,210,819 F674L probably benign Het
Syne2 A T 12: 75,938,721 N1648Y probably benign Het
Thsd7a G T 6: 12,332,017 N1265K possibly damaging Het
Trem2 T C 17: 48,351,774 L189P probably benign Het
Washc4 A T 10: 83,581,337 R865S probably damaging Het
Zfp536 A G 7: 37,568,792 S400P probably damaging Het
Other mutations in Gab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Gab2 APN 7 97302443 missense possibly damaging 0.91
IGL00325:Gab2 APN 7 97299258 missense probably damaging 1.00
IGL01832:Gab2 APN 7 97304238 missense probably damaging 1.00
IGL01955:Gab2 APN 7 97304223 missense probably damaging 1.00
IGL02664:Gab2 APN 7 97304182 missense probably damaging 1.00
R0105:Gab2 UTSW 7 97299072 missense probably damaging 1.00
R0105:Gab2 UTSW 7 97299072 missense probably damaging 1.00
R0243:Gab2 UTSW 7 97299241 missense probably damaging 0.96
R0827:Gab2 UTSW 7 97300332 missense probably damaging 1.00
R1696:Gab2 UTSW 7 97223633 missense probably damaging 1.00
R1872:Gab2 UTSW 7 97299043 missense probably damaging 0.99
R2973:Gab2 UTSW 7 97223552 missense probably benign 0.07
R3195:Gab2 UTSW 7 97272029 missense probably benign
R3827:Gab2 UTSW 7 97223741 missense probably damaging 1.00
R3910:Gab2 UTSW 7 97299073 missense probably damaging 1.00
R3911:Gab2 UTSW 7 97299073 missense probably damaging 1.00
R3912:Gab2 UTSW 7 97299073 missense probably damaging 1.00
R4604:Gab2 UTSW 7 97304213 missense probably damaging 0.99
R5655:Gab2 UTSW 7 97298892 missense probably benign
R6299:Gab2 UTSW 7 97081859 missense probably benign 0.00
R7038:Gab2 UTSW 7 97303083 missense probably damaging 1.00
R7313:Gab2 UTSW 7 97081798 start gained probably benign
R7586:Gab2 UTSW 7 97301438 missense probably damaging 1.00
R7729:Gab2 UTSW 7 97301426 missense probably damaging 1.00
R8434:Gab2 UTSW 7 97299130 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAACTCAGGTGAGAGGCC -3'
(R):5'- TGTCTCTCCAAGGACACCCATC -3'

Sequencing Primer
(F):5'- CCAGGTCTGGGGTTAAGAAC -3'
(R):5'- CTTTAAAACACAGATGTCCTTGGGGG -3'
Posted On2016-10-05