Incidental Mutation 'R5506:Olfr857'
ID430926
Institutional Source Beutler Lab
Gene Symbol Olfr857
Ensembl Gene ENSMUSG00000094678
Gene Nameolfactory receptor 857
SynonymsMOR146-8P, GA_x6K02T2PVTD-13452606-13453535
MMRRC Submission 043067-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R5506 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location19709433-19714930 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19713274 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 149 (L149P)
Ref Sequence ENSEMBL: ENSMUSP00000150889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077023] [ENSMUST00000212013] [ENSMUST00000217450]
Predicted Effect probably benign
Transcript: ENSMUST00000077023
AA Change: L149P

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000076281
Gene: ENSMUSG00000094678
AA Change: L149P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.5e-49 PFAM
Pfam:7TM_GPCR_Srsx 35 304 1.5e-5 PFAM
Pfam:7tm_1 41 290 9.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212013
AA Change: L149P

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212753
AA Change: L114P
Predicted Effect possibly damaging
Transcript: ENSMUST00000217450
AA Change: L149P

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,067,947 G966W probably damaging Het
3110002H16Rik A G 18: 12,188,956 probably benign Het
A930009A15Rik G T 10: 115,578,362 probably null Het
Cant1 G T 11: 118,411,442 H16Q probably benign Het
Capn3 G T 2: 120,502,420 V612F probably damaging Het
Cep112 A T 11: 108,664,603 E141D probably damaging Het
Cept1 A G 3: 106,531,248 V173A probably benign Het
CN725425 A G 15: 91,235,826 D50G possibly damaging Het
Cubn A T 2: 13,491,695 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dpp8 A G 9: 65,078,109 probably null Het
Ecm1 G A 3: 95,735,857 T377I probably benign Het
Exosc8 A G 3: 54,731,179 probably benign Het
Fam129b G A 2: 32,920,982 V335M probably damaging Het
Fam71f1 G A 6: 29,319,298 E34K probably damaging Het
Fasn C T 11: 120,809,510 D2165N probably benign Het
Gab2 A G 7: 97,303,113 E571G probably damaging Het
Galnt5 C A 2: 57,999,625 H412Q probably benign Het
Galr1 T A 18: 82,405,864 Y96F possibly damaging Het
Gm8882 T C 6: 132,361,856 N133S unknown Het
Gnl2 C A 4: 125,055,365 probably benign Het
H2afx T C 9: 44,335,105 V115A probably benign Het
Heatr9 T C 11: 83,514,766 N317S possibly damaging Het
Hist1h2an A C 13: 21,786,911 I103S probably damaging Het
Kndc1 A G 7: 139,927,891 Y1254C probably damaging Het
Lrp6 A T 6: 134,459,296 D1302E probably benign Het
Mc2r A T 18: 68,407,948 Y91* probably null Het
Meis1 T G 11: 18,941,747 D267A possibly damaging Het
Mki67 T C 7: 135,699,981 K1108R possibly damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myh3 T G 11: 67,084,089 D219E probably damaging Het
Olfr1511 T C 14: 52,390,627 I49V probably damaging Het
Pi4ka A G 16: 17,293,953 C1553R probably damaging Het
Plekhb1 C A 7: 100,644,943 probably null Het
Polr3d A T 14: 70,440,759 D165E possibly damaging Het
Psmb1 A G 17: 15,490,216 Y24H probably damaging Het
Rab11fip5 A G 6: 85,374,137 L131P probably damaging Het
Raph1 A T 1: 60,493,498 probably benign Het
Scgb2b27 T G 7: 34,012,059 probably benign Het
Serpina10 T C 12: 103,626,661 D264G probably damaging Het
Sftpb A G 6: 72,304,667 T15A possibly damaging Het
Slc20a1 T C 2: 129,210,819 F674L probably benign Het
Syne2 A T 12: 75,938,721 N1648Y probably benign Het
Thsd7a G T 6: 12,332,017 N1265K possibly damaging Het
Trem2 T C 17: 48,351,774 L189P probably benign Het
Washc4 A T 10: 83,581,337 R865S probably damaging Het
Zfp536 A G 7: 37,568,792 S400P probably damaging Het
Other mutations in Olfr857
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Olfr857 APN 9 19713279 missense probably benign 0.00
IGL01919:Olfr857 APN 9 19713342 missense probably benign 0.00
IGL02157:Olfr857 APN 9 19713289 missense probably benign 0.07
IGL02550:Olfr857 APN 9 19713047 missense possibly damaging 0.92
IGL03329:Olfr857 APN 9 19713301 missense probably benign 0.16
IGL02799:Olfr857 UTSW 9 19713018 missense probably damaging 0.99
R0356:Olfr857 UTSW 9 19713447 missense probably damaging 1.00
R0927:Olfr857 UTSW 9 19713649 missense probably benign 0.39
R1161:Olfr857 UTSW 9 19713180 missense probably damaging 1.00
R1848:Olfr857 UTSW 9 19713090 missense probably benign 0.01
R5191:Olfr857 UTSW 9 19713334 missense probably damaging 0.98
R5216:Olfr857 UTSW 9 19713289 missense probably benign 0.07
R5259:Olfr857 UTSW 9 19712813 intron probably null
R5342:Olfr857 UTSW 9 19713037 missense probably damaging 1.00
R5526:Olfr857 UTSW 9 19713698 nonsense probably null
R5594:Olfr857 UTSW 9 19713006 missense probably damaging 0.99
R5928:Olfr857 UTSW 9 19713753 missense probably benign 0.02
R6569:Olfr857 UTSW 9 19713342 missense probably benign 0.00
R6858:Olfr857 UTSW 9 19713469 missense probably damaging 0.98
R7077:Olfr857 UTSW 9 19713132 missense probably benign
R7378:Olfr857 UTSW 9 19712887 missense probably damaging 1.00
R7771:Olfr857 UTSW 9 19713471 missense probably benign
R8038:Olfr857 UTSW 9 19713680 missense possibly damaging 0.52
R8160:Olfr857 UTSW 9 19712789 intron probably benign
R8223:Olfr857 UTSW 9 19713409 missense probably benign
R8400:Olfr857 UTSW 9 19713093 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- TTGCATGCCCATAACAGATCC -3'
(R):5'- TAGGAGTAAAATATTCCTGAGGCAG -3'

Sequencing Primer
(F):5'- CAGATCCATAACTTATGCTGAATGCC -3'
(R):5'- GAGGAAACCAAGAATGATGCC -3'
Posted On2016-10-05