Incidental Mutation 'R5506:Dnajb12'
ID430929
Institutional Source Beutler Lab
Gene Symbol Dnajb12
Ensembl Gene ENSMUSG00000020109
Gene NameDnaJ heat shock protein family (Hsp40) member B12
SynonymsmDj10
MMRRC Submission 043067-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R5506 (G1)
Quality Score217
Status Validated
Chromosome10
Chromosomal Location59879556-59899302 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GC to G at 59892752 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020309] [ENSMUST00000131810] [ENSMUST00000142819] [ENSMUST00000146590] [ENSMUST00000147914]
Predicted Effect probably null
Transcript: ENSMUST00000020309
SMART Domains Protein: ENSMUSP00000020309
Gene: ENSMUSG00000020109

DomainStartEndE-ValueType
low complexity region 57 80 N/A INTRINSIC
low complexity region 81 94 N/A INTRINSIC
DnaJ 110 167 3.18e-30 SMART
low complexity region 231 244 N/A INTRINSIC
Pfam:DUF1977 262 370 2.8e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131810
SMART Domains Protein: ENSMUSP00000116244
Gene: ENSMUSG00000020109

DomainStartEndE-ValueType
SCOP:d1a17__ 2 40 4e-3 SMART
low complexity region 57 80 N/A INTRINSIC
low complexity region 81 94 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000142819
SMART Domains Protein: ENSMUSP00000118088
Gene: ENSMUSG00000020109

DomainStartEndE-ValueType
low complexity region 57 80 N/A INTRINSIC
low complexity region 81 94 N/A INTRINSIC
DnaJ 110 167 3.18e-30 SMART
low complexity region 231 244 N/A INTRINSIC
Pfam:DUF1977 262 370 2.8e-44 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000146590
SMART Domains Protein: ENSMUSP00000122056
Gene: ENSMUSG00000020109

DomainStartEndE-ValueType
low complexity region 57 80 N/A INTRINSIC
low complexity region 81 94 N/A INTRINSIC
DnaJ 110 167 3.18e-30 SMART
low complexity region 231 244 N/A INTRINSIC
Pfam:DUF1977 262 370 2.8e-44 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000147914
SMART Domains Protein: ENSMUSP00000116577
Gene: ENSMUSG00000020109

DomainStartEndE-ValueType
low complexity region 57 80 N/A INTRINSIC
low complexity region 81 94 N/A INTRINSIC
DnaJ 110 167 3.18e-30 SMART
low complexity region 231 244 N/A INTRINSIC
Pfam:DUF1977 263 369 9.2e-31 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNAJB12 belongs to the evolutionarily conserved DNAJ/HSP40 family of proteins, which regulate molecular chaperone activity by stimulating ATPase activity. DNAJ proteins may have up to 3 distinct domains: a conserved 70-amino acid J domain, usually at the N terminus; a glycine/phenylalanine (G/F)-rich region; and a cysteine-rich domain containing 4 motifs resembling a zinc finger domain (Ohtsuka and Hata, 2000 [PubMed 11147971]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,067,947 G966W probably damaging Het
3110002H16Rik A G 18: 12,188,956 probably benign Het
A930009A15Rik G T 10: 115,578,362 probably null Het
Cant1 G T 11: 118,411,442 H16Q probably benign Het
Capn3 G T 2: 120,502,420 V612F probably damaging Het
Cep112 A T 11: 108,664,603 E141D probably damaging Het
Cept1 A G 3: 106,531,248 V173A probably benign Het
CN725425 A G 15: 91,235,826 D50G possibly damaging Het
Cubn A T 2: 13,491,695 probably null Het
Dpp8 A G 9: 65,078,109 probably null Het
Ecm1 G A 3: 95,735,857 T377I probably benign Het
Exosc8 A G 3: 54,731,179 probably benign Het
Fam129b G A 2: 32,920,982 V335M probably damaging Het
Fam71f1 G A 6: 29,319,298 E34K probably damaging Het
Fasn C T 11: 120,809,510 D2165N probably benign Het
Gab2 A G 7: 97,303,113 E571G probably damaging Het
Galnt5 C A 2: 57,999,625 H412Q probably benign Het
Galr1 T A 18: 82,405,864 Y96F possibly damaging Het
Gm8882 T C 6: 132,361,856 N133S unknown Het
Gnl2 C A 4: 125,055,365 probably benign Het
H2afx T C 9: 44,335,105 V115A probably benign Het
Heatr9 T C 11: 83,514,766 N317S possibly damaging Het
Hist1h2an A C 13: 21,786,911 I103S probably damaging Het
Kndc1 A G 7: 139,927,891 Y1254C probably damaging Het
Lrp6 A T 6: 134,459,296 D1302E probably benign Het
Mc2r A T 18: 68,407,948 Y91* probably null Het
Meis1 T G 11: 18,941,747 D267A possibly damaging Het
Mki67 T C 7: 135,699,981 K1108R possibly damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myh3 T G 11: 67,084,089 D219E probably damaging Het
Olfr1511 T C 14: 52,390,627 I49V probably damaging Het
Olfr857 T C 9: 19,713,274 L149P possibly damaging Het
Pi4ka A G 16: 17,293,953 C1553R probably damaging Het
Plekhb1 C A 7: 100,644,943 probably null Het
Polr3d A T 14: 70,440,759 D165E possibly damaging Het
Psmb1 A G 17: 15,490,216 Y24H probably damaging Het
Rab11fip5 A G 6: 85,374,137 L131P probably damaging Het
Raph1 A T 1: 60,493,498 probably benign Het
Scgb2b27 T G 7: 34,012,059 probably benign Het
Serpina10 T C 12: 103,626,661 D264G probably damaging Het
Sftpb A G 6: 72,304,667 T15A possibly damaging Het
Slc20a1 T C 2: 129,210,819 F674L probably benign Het
Syne2 A T 12: 75,938,721 N1648Y probably benign Het
Thsd7a G T 6: 12,332,017 N1265K possibly damaging Het
Trem2 T C 17: 48,351,774 L189P probably benign Het
Washc4 A T 10: 83,581,337 R865S probably damaging Het
Zfp536 A G 7: 37,568,792 S400P probably damaging Het
Other mutations in Dnajb12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02616:Dnajb12 APN 10 59892863 splice site probably null
IGL03412:Dnajb12 APN 10 59890073 missense probably benign 0.44
PIT4382001:Dnajb12 UTSW 10 59892686 missense probably damaging 1.00
R0496:Dnajb12 UTSW 10 59879801 nonsense probably null
R1692:Dnajb12 UTSW 10 59896377 missense probably damaging 1.00
R2087:Dnajb12 UTSW 10 59890845 missense possibly damaging 0.82
R2276:Dnajb12 UTSW 10 59892977 missense probably benign 0.31
R4110:Dnajb12 UTSW 10 59894314 missense possibly damaging 0.78
R4113:Dnajb12 UTSW 10 59894314 missense possibly damaging 0.78
R4365:Dnajb12 UTSW 10 59879766 missense probably damaging 1.00
R4382:Dnajb12 UTSW 10 59897499 missense probably benign
R4757:Dnajb12 UTSW 10 59892770 missense probably benign
R5156:Dnajb12 UTSW 10 59892960 missense probably damaging 1.00
R5455:Dnajb12 UTSW 10 59892752 frame shift probably null
R5484:Dnajb12 UTSW 10 59892752 frame shift probably null
R5486:Dnajb12 UTSW 10 59892752 frame shift probably null
R5487:Dnajb12 UTSW 10 59892752 frame shift probably null
R5504:Dnajb12 UTSW 10 59892752 frame shift probably null
R5507:Dnajb12 UTSW 10 59892752 frame shift probably null
R5560:Dnajb12 UTSW 10 59892752 frame shift probably null
R5561:Dnajb12 UTSW 10 59892752 frame shift probably null
R5601:Dnajb12 UTSW 10 59892752 frame shift probably null
R5603:Dnajb12 UTSW 10 59892752 frame shift probably null
R5604:Dnajb12 UTSW 10 59892752 frame shift probably null
R6013:Dnajb12 UTSW 10 59894341 critical splice donor site probably null
R6724:Dnajb12 UTSW 10 59892780 missense possibly damaging 0.92
R6935:Dnajb12 UTSW 10 59896503 critical splice donor site probably null
R8044:Dnajb12 UTSW 10 59896350 missense possibly damaging 0.88
R8073:Dnajb12 UTSW 10 59890179 nonsense probably null
X0022:Dnajb12 UTSW 10 59892976 missense probably null 0.00
Z1088:Dnajb12 UTSW 10 59890054 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TTAGCCTTGCCTAGAGGTGC -3'
(R):5'- CGTTACCTGAAACATGGAGATAGAG -3'

Sequencing Primer
(F):5'- TCTGGATTGCCTGCCCAACAG -3'
(R):5'- TAGAGTCAGGGGCTGCAGC -3'
Posted On2016-10-05