Incidental Mutation 'R5506:A930009A15Rik'
List |< first << previous [record 3 of 48] next >> last >|
ID430931
Institutional Source Beutler Lab
Gene Symbol A930009A15Rik
Ensembl Gene ENSMUSG00000092210
Gene NameRIKEN cDNA A930009A15 gene
Synonyms
MMRRC Submission 043067-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R5506 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location115569986-115582448 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 115578362 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020350] [ENSMUST00000172806] [ENSMUST00000173620] [ENSMUST00000173740]
Predicted Effect probably benign
Transcript: ENSMUST00000020350
SMART Domains Protein: ENSMUSP00000020350
Gene: ENSMUSG00000020140

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LRRNT 33 70 1.43e-5 SMART
LRR 64 88 1.41e2 SMART
LRR_TYP 89 112 3.44e-4 SMART
LRR_TYP 113 136 9.88e-5 SMART
LRR_TYP 137 160 9.73e-4 SMART
LRR_TYP 161 184 5.21e-4 SMART
LRR 185 208 6.22e0 SMART
LRR_TYP 209 232 3.89e-3 SMART
LRR 233 255 9.75e0 SMART
LRR_TYP 256 279 1.38e-3 SMART
Blast:LRR 281 303 2e-6 BLAST
Blast:LRR 304 328 1e-5 BLAST
LRR_TYP 351 374 1.56e-2 SMART
LRR 375 396 1.09e2 SMART
LRR_TYP 397 420 7.26e-3 SMART
LRR 421 444 2.86e-1 SMART
low complexity region 518 533 N/A INTRINSIC
Pfam:7tm_1 574 820 9.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149008
Predicted Effect probably benign
Transcript: ENSMUST00000172806
SMART Domains Protein: ENSMUSP00000133860
Gene: ENSMUSG00000020140

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LRRNT 33 70 1.43e-5 SMART
LRR 64 88 1.41e2 SMART
LRR_TYP 89 112 3.44e-4 SMART
LRR_TYP 113 136 9.88e-5 SMART
LRR_TYP 137 160 9.73e-4 SMART
LRR_TYP 161 184 5.21e-4 SMART
LRR 185 208 6.22e0 SMART
LRR_TYP 209 232 3.89e-3 SMART
LRR 233 255 9.75e0 SMART
LRR 256 279 6.57e-1 SMART
Blast:LRR 280 304 1e-5 BLAST
LRR_TYP 327 350 1.56e-2 SMART
LRR 351 372 1.09e2 SMART
LRR_TYP 373 396 7.26e-3 SMART
LRR 397 420 2.86e-1 SMART
low complexity region 494 509 N/A INTRINSIC
Pfam:7tm_1 550 796 8.2e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000173620
Predicted Effect probably benign
Transcript: ENSMUST00000173740
SMART Domains Protein: ENSMUSP00000133707
Gene: ENSMUSG00000020140

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LRRNT 33 70 1.43e-5 SMART
LRR 64 88 1.41e2 SMART
LRR_TYP 89 112 3.44e-4 SMART
LRR_TYP 113 136 9.88e-5 SMART
LRR_TYP 137 160 9.08e-4 SMART
LRR 161 183 9.75e0 SMART
LRR_TYP 184 207 1.38e-3 SMART
Blast:LRR 209 231 1e-6 BLAST
Blast:LRR 232 256 1e-5 BLAST
LRR_TYP 279 302 1.56e-2 SMART
LRR 303 324 1.09e2 SMART
LRR_TYP 325 348 7.26e-3 SMART
LRR 349 372 2.86e-1 SMART
low complexity region 446 461 N/A INTRINSIC
Pfam:7tm_1 502 748 7.4e-16 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,067,947 G966W probably damaging Het
3110002H16Rik A G 18: 12,188,956 probably benign Het
Cant1 G T 11: 118,411,442 H16Q probably benign Het
Capn3 G T 2: 120,502,420 V612F probably damaging Het
Cep112 A T 11: 108,664,603 E141D probably damaging Het
Cept1 A G 3: 106,531,248 V173A probably benign Het
CN725425 A G 15: 91,235,826 D50G possibly damaging Het
Cubn A T 2: 13,491,695 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dpp8 A G 9: 65,078,109 probably null Het
Ecm1 G A 3: 95,735,857 T377I probably benign Het
Exosc8 A G 3: 54,731,179 probably benign Het
Fam129b G A 2: 32,920,982 V335M probably damaging Het
Fam71f1 G A 6: 29,319,298 E34K probably damaging Het
Fasn C T 11: 120,809,510 D2165N probably benign Het
Gab2 A G 7: 97,303,113 E571G probably damaging Het
Galnt5 C A 2: 57,999,625 H412Q probably benign Het
Galr1 T A 18: 82,405,864 Y96F possibly damaging Het
Gm8882 T C 6: 132,361,856 N133S unknown Het
Gnl2 C A 4: 125,055,365 probably benign Het
H2afx T C 9: 44,335,105 V115A probably benign Het
Heatr9 T C 11: 83,514,766 N317S possibly damaging Het
Hist1h2an A C 13: 21,786,911 I103S probably damaging Het
Kndc1 A G 7: 139,927,891 Y1254C probably damaging Het
Lrp6 A T 6: 134,459,296 D1302E probably benign Het
Mc2r A T 18: 68,407,948 Y91* probably null Het
Meis1 T G 11: 18,941,747 D267A possibly damaging Het
Mki67 T C 7: 135,699,981 K1108R possibly damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myh3 T G 11: 67,084,089 D219E probably damaging Het
Olfr1511 T C 14: 52,390,627 I49V probably damaging Het
Olfr857 T C 9: 19,713,274 L149P possibly damaging Het
Pi4ka A G 16: 17,293,953 C1553R probably damaging Het
Plekhb1 C A 7: 100,644,943 probably null Het
Polr3d A T 14: 70,440,759 D165E possibly damaging Het
Psmb1 A G 17: 15,490,216 Y24H probably damaging Het
Rab11fip5 A G 6: 85,374,137 L131P probably damaging Het
Raph1 A T 1: 60,493,498 probably benign Het
Scgb2b27 T G 7: 34,012,059 probably benign Het
Serpina10 T C 12: 103,626,661 D264G probably damaging Het
Sftpb A G 6: 72,304,667 T15A possibly damaging Het
Slc20a1 T C 2: 129,210,819 F674L probably benign Het
Syne2 A T 12: 75,938,721 N1648Y probably benign Het
Thsd7a G T 6: 12,332,017 N1265K possibly damaging Het
Trem2 T C 17: 48,351,774 L189P probably benign Het
Washc4 A T 10: 83,581,337 R865S probably damaging Het
Zfp536 A G 7: 37,568,792 S400P probably damaging Het
Other mutations in A930009A15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1871:A930009A15Rik UTSW 10 115579794 splice site probably null
R3791:A930009A15Rik UTSW 10 115578289 intron probably benign
R5463:A930009A15Rik UTSW 10 115570199 intron probably benign
R5486:A930009A15Rik UTSW 10 115579905 intron probably benign
R5966:A930009A15Rik UTSW 10 115579812 intron probably benign
R6538:A930009A15Rik UTSW 10 115570199 intron probably benign
R6805:A930009A15Rik UTSW 10 115579905 intron probably benign
R7574:A930009A15Rik UTSW 10 115570114 intron probably benign
R7585:A930009A15Rik UTSW 10 115578325 missense unknown
R7607:A930009A15Rik UTSW 10 115581989 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GAGTTCTCCAAATGAGCTATGTGC -3'
(R):5'- ACCAGACAACTGTCCTTGGG -3'

Sequencing Primer
(F):5'- GCTTACATCCTGGGAGAATCG -3'
(R):5'- ACAACTGTCCTTGGGCTGTGTAC -3'
Posted On2016-10-05