Incidental Mutation 'R5506:Serpina10'
ID430939
Institutional Source Beutler Lab
Gene Symbol Serpina10
Ensembl Gene ENSMUSG00000061947
Gene Nameserine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10
SynonymsPZI
MMRRC Submission 043067-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R5506 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location103614786-103631444 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103626661 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 264 (D264G)
Ref Sequence ENSEMBL: ENSMUSP00000113644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044231] [ENSMUST00000121625]
Predicted Effect probably damaging
Transcript: ENSMUST00000044231
AA Change: D318G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048357
Gene: ENSMUSG00000061947
AA Change: D318G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 46 71 N/A INTRINSIC
SERPIN 88 445 2.79e-105 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121625
AA Change: D264G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113644
Gene: ENSMUSG00000061947
AA Change: D264G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 46 71 N/A INTRINSIC
SERPIN 88 391 3.12e-53 SMART
Meta Mutation Damage Score 0.0890 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the large serpin family of proteins, and is also known as serpin PZ-dependent protease inhibitor (ZPI or PZI). This protein is thought to play an important role in the regulation of coagulation. It directly inhibits factor XIa, and also inhibits factor Xa in the presence of calcium, phospholipids, and protein Z (PZ). Deficiencies in this gene lead to an increase in thrombosis. Alternative splicing results in multiple transcript variants that encode multiple protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display a reduced survival rate, enhanced thrombosis after ferric chloride-induced carotid artery injury, and increased mortality from pulmonary thromboembolism following collagen/epinephrine infusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,067,947 G966W probably damaging Het
3110002H16Rik A G 18: 12,188,956 probably benign Het
A930009A15Rik G T 10: 115,578,362 probably null Het
Cant1 G T 11: 118,411,442 H16Q probably benign Het
Capn3 G T 2: 120,502,420 V612F probably damaging Het
Cep112 A T 11: 108,664,603 E141D probably damaging Het
Cept1 A G 3: 106,531,248 V173A probably benign Het
CN725425 A G 15: 91,235,826 D50G possibly damaging Het
Cubn A T 2: 13,491,695 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dpp8 A G 9: 65,078,109 probably null Het
Ecm1 G A 3: 95,735,857 T377I probably benign Het
Exosc8 A G 3: 54,731,179 probably benign Het
Fam129b G A 2: 32,920,982 V335M probably damaging Het
Fam71f1 G A 6: 29,319,298 E34K probably damaging Het
Fasn C T 11: 120,809,510 D2165N probably benign Het
Gab2 A G 7: 97,303,113 E571G probably damaging Het
Galnt5 C A 2: 57,999,625 H412Q probably benign Het
Galr1 T A 18: 82,405,864 Y96F possibly damaging Het
Gm8882 T C 6: 132,361,856 N133S unknown Het
Gnl2 C A 4: 125,055,365 probably benign Het
H2afx T C 9: 44,335,105 V115A probably benign Het
Heatr9 T C 11: 83,514,766 N317S possibly damaging Het
Hist1h2an A C 13: 21,786,911 I103S probably damaging Het
Kndc1 A G 7: 139,927,891 Y1254C probably damaging Het
Lrp6 A T 6: 134,459,296 D1302E probably benign Het
Mc2r A T 18: 68,407,948 Y91* probably null Het
Meis1 T G 11: 18,941,747 D267A possibly damaging Het
Mki67 T C 7: 135,699,981 K1108R possibly damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myh3 T G 11: 67,084,089 D219E probably damaging Het
Olfr1511 T C 14: 52,390,627 I49V probably damaging Het
Olfr857 T C 9: 19,713,274 L149P possibly damaging Het
Pi4ka A G 16: 17,293,953 C1553R probably damaging Het
Plekhb1 C A 7: 100,644,943 probably null Het
Polr3d A T 14: 70,440,759 D165E possibly damaging Het
Psmb1 A G 17: 15,490,216 Y24H probably damaging Het
Rab11fip5 A G 6: 85,374,137 L131P probably damaging Het
Raph1 A T 1: 60,493,498 probably benign Het
Scgb2b27 T G 7: 34,012,059 probably benign Het
Sftpb A G 6: 72,304,667 T15A possibly damaging Het
Slc20a1 T C 2: 129,210,819 F674L probably benign Het
Syne2 A T 12: 75,938,721 N1648Y probably benign Het
Thsd7a G T 6: 12,332,017 N1265K possibly damaging Het
Trem2 T C 17: 48,351,774 L189P probably benign Het
Washc4 A T 10: 83,581,337 R865S probably damaging Het
Zfp536 A G 7: 37,568,792 S400P probably damaging Het
Other mutations in Serpina10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02261:Serpina10 APN 12 103616949 missense probably damaging 1.00
IGL02411:Serpina10 APN 12 103616943 missense possibly damaging 0.94
R0051:Serpina10 UTSW 12 103626897 intron probably benign
R0051:Serpina10 UTSW 12 103626897 intron probably benign
R0526:Serpina10 UTSW 12 103616868 missense probably damaging 1.00
R1387:Serpina10 UTSW 12 103628241 missense probably benign
R1986:Serpina10 UTSW 12 103628255 missense possibly damaging 0.95
R2277:Serpina10 UTSW 12 103626743 missense probably benign 0.13
R4227:Serpina10 UTSW 12 103628415 missense probably damaging 0.99
R5237:Serpina10 UTSW 12 103628816 missense probably benign 0.39
R6144:Serpina10 UTSW 12 103628833 missense probably benign 0.01
R6726:Serpina10 UTSW 12 103628369 missense probably benign 0.40
R6819:Serpina10 UTSW 12 103628360 missense probably benign 0.05
R7351:Serpina10 UTSW 12 103628935 missense probably benign
R7780:Serpina10 UTSW 12 103628547 missense probably benign 0.01
R8052:Serpina10 UTSW 12 103628310 missense probably damaging 0.99
R8094:Serpina10 UTSW 12 103628773 small deletion probably benign
R8213:Serpina10 UTSW 12 103628277 missense probably benign 0.01
R8318:Serpina10 UTSW 12 103616848 missense possibly damaging 0.58
Y4337:Serpina10 UTSW 12 103624476 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GGCCTAACCAGGATTGATGC -3'
(R):5'- TCACTGAGGCCGACACTTTC -3'

Sequencing Primer
(F):5'- CCTAACCAGGATTGATGCTCAGG -3'
(R):5'- TTTCCACCTGGACAAGTACAG -3'
Posted On2016-10-05