Incidental Mutation 'R5506:CN725425'
ID430944
Institutional Source Beutler Lab
Gene Symbol CN725425
Ensembl Gene ENSMUSG00000078932
Gene NamecDNA sequence CN725425
SynonymsGm5807
MMRRC Submission 043067-MU
Accession Numbers

Ensembl: ENSMUST00000109284; MGI: 3613655

Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R5506 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location91199494-91260894 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91235826 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 50 (D50G)
Ref Sequence ENSEMBL: ENSMUSP00000140772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109284] [ENSMUST00000190436]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109284
AA Change: D43G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104907
Gene: ENSMUSG00000078932
AA Change: D43G

DomainStartEndE-ValueType
low complexity region 21 41 N/A INTRINSIC
Pfam:DUF4552 219 643 2.7e-202 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000190436
AA Change: D50G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140772
Gene: ENSMUSG00000078932
AA Change: D50G

DomainStartEndE-ValueType
low complexity region 28 48 N/A INTRINSIC
Pfam:DUF4552 226 650 1.4e-184 PFAM
Meta Mutation Damage Score 0.4942 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,067,947 G966W probably damaging Het
3110002H16Rik A G 18: 12,188,956 probably benign Het
A930009A15Rik G T 10: 115,578,362 probably null Het
Cant1 G T 11: 118,411,442 H16Q probably benign Het
Capn3 G T 2: 120,502,420 V612F probably damaging Het
Cep112 A T 11: 108,664,603 E141D probably damaging Het
Cept1 A G 3: 106,531,248 V173A probably benign Het
Cubn A T 2: 13,491,695 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dpp8 A G 9: 65,078,109 probably null Het
Ecm1 G A 3: 95,735,857 T377I probably benign Het
Exosc8 A G 3: 54,731,179 probably benign Het
Fam129b G A 2: 32,920,982 V335M probably damaging Het
Fam71f1 G A 6: 29,319,298 E34K probably damaging Het
Fasn C T 11: 120,809,510 D2165N probably benign Het
Gab2 A G 7: 97,303,113 E571G probably damaging Het
Galnt5 C A 2: 57,999,625 H412Q probably benign Het
Galr1 T A 18: 82,405,864 Y96F possibly damaging Het
Gm8882 T C 6: 132,361,856 N133S unknown Het
Gnl2 C A 4: 125,055,365 probably benign Het
H2afx T C 9: 44,335,105 V115A probably benign Het
Heatr9 T C 11: 83,514,766 N317S possibly damaging Het
Hist1h2an A C 13: 21,786,911 I103S probably damaging Het
Kndc1 A G 7: 139,927,891 Y1254C probably damaging Het
Lrp6 A T 6: 134,459,296 D1302E probably benign Het
Mc2r A T 18: 68,407,948 Y91* probably null Het
Meis1 T G 11: 18,941,747 D267A possibly damaging Het
Mki67 T C 7: 135,699,981 K1108R possibly damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myh3 T G 11: 67,084,089 D219E probably damaging Het
Olfr1511 T C 14: 52,390,627 I49V probably damaging Het
Olfr857 T C 9: 19,713,274 L149P possibly damaging Het
Pi4ka A G 16: 17,293,953 C1553R probably damaging Het
Plekhb1 C A 7: 100,644,943 probably null Het
Polr3d A T 14: 70,440,759 D165E possibly damaging Het
Psmb1 A G 17: 15,490,216 Y24H probably damaging Het
Rab11fip5 A G 6: 85,374,137 L131P probably damaging Het
Raph1 A T 1: 60,493,498 probably benign Het
Scgb2b27 T G 7: 34,012,059 probably benign Het
Serpina10 T C 12: 103,626,661 D264G probably damaging Het
Sftpb A G 6: 72,304,667 T15A possibly damaging Het
Slc20a1 T C 2: 129,210,819 F674L probably benign Het
Syne2 A T 12: 75,938,721 N1648Y probably benign Het
Thsd7a G T 6: 12,332,017 N1265K possibly damaging Het
Trem2 T C 17: 48,351,774 L189P probably benign Het
Washc4 A T 10: 83,581,337 R865S probably damaging Het
Zfp536 A G 7: 37,568,792 S400P probably damaging Het
Other mutations in CN725425
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01541:CN725425 APN 15 91245752 missense possibly damaging 0.71
IGL02176:CN725425 APN 15 91245821 missense probably benign
3-1:CN725425 UTSW 15 91260521 missense possibly damaging 0.52
R0449:CN725425 UTSW 15 91238944 missense possibly damaging 0.73
R0554:CN725425 UTSW 15 91260763 missense possibly damaging 0.86
R1442:CN725425 UTSW 15 91238955 missense possibly damaging 0.96
R1670:CN725425 UTSW 15 91245815 missense possibly damaging 0.86
R1674:CN725425 UTSW 15 91246921 missense possibly damaging 0.93
R2425:CN725425 UTSW 15 91245855 missense probably damaging 0.97
R3966:CN725425 UTSW 15 91242687 critical splice donor site probably null
R4959:CN725425 UTSW 15 91245701 missense possibly damaging 0.92
R4973:CN725425 UTSW 15 91245701 missense possibly damaging 0.92
R5512:CN725425 UTSW 15 91240756 missense probably benign
R5726:CN725425 UTSW 15 91260503 missense possibly damaging 0.85
R5808:CN725425 UTSW 15 91245644 missense probably benign 0.32
R5820:CN725425 UTSW 15 91260697 missense possibly damaging 0.71
R5945:CN725425 UTSW 15 91245777 missense possibly damaging 0.86
R6366:CN725425 UTSW 15 91246921 missense possibly damaging 0.93
R6441:CN725425 UTSW 15 91235802 missense probably benign 0.33
R6484:CN725425 UTSW 15 91260572 missense probably benign 0.32
R6523:CN725425 UTSW 15 91231581 missense probably benign 0.01
R6721:CN725425 UTSW 15 91231618 missense possibly damaging 0.53
R6901:CN725425 UTSW 15 91240763 missense possibly damaging 0.93
R7341:CN725425 UTSW 15 91242670 missense possibly damaging 0.96
R7654:CN725425 UTSW 15 91239435 missense probably benign 0.04
R7704:CN725425 UTSW 15 91235790 missense possibly damaging 0.86
R7709:CN725425 UTSW 15 91240727 missense probably benign
R7880:CN725425 UTSW 15 91246105 nonsense probably null
R8371:CN725425 UTSW 15 91240770 missense probably benign 0.33
Z1088:CN725425 UTSW 15 91245762 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCTTGATAGCCTCTATGCATTTATGG -3'
(R):5'- GCTAAACTTTGGTGACTATTTGCCTAG -3'

Sequencing Primer
(F):5'- AGCCTCTATGCATTTATGGTTTATG -3'
(R):5'- AATGTGTGTACATACTCGCGCAC -3'
Posted On2016-10-05