Incidental Mutation 'R5506:Psmb1'
List |< first << previous [record 37 of 48] next >> last >|
ID430946
Institutional Source Beutler Lab
Gene Symbol Psmb1
Ensembl Gene ENSMUSG00000014769
Gene Nameproteasome (prosome, macropain) subunit, beta type 1
SynonymsLmpc5
MMRRC Submission 043067-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R5506 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location15475021-15499751 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 15490216 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 24 (Y24H)
Ref Sequence ENSEMBL: ENSMUSP00000156359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014913] [ENSMUST00000231341] [ENSMUST00000232500]
Predicted Effect probably damaging
Transcript: ENSMUST00000014913
AA Change: Y124H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000014913
Gene: ENSMUSG00000014769
AA Change: Y124H

DomainStartEndE-ValueType
Pfam:Proteasome 33 225 8.9e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000231341
AA Change: Y124H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000232500
AA Change: Y24H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9000 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. This gene is tightly linked to the TBP (TATA-binding protein) gene in human and in mouse, and is transcribed in the opposite orientation in both species. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,067,947 G966W probably damaging Het
3110002H16Rik A G 18: 12,188,956 probably benign Het
A930009A15Rik G T 10: 115,578,362 probably null Het
Cant1 G T 11: 118,411,442 H16Q probably benign Het
Capn3 G T 2: 120,502,420 V612F probably damaging Het
Cep112 A T 11: 108,664,603 E141D probably damaging Het
Cept1 A G 3: 106,531,248 V173A probably benign Het
CN725425 A G 15: 91,235,826 D50G possibly damaging Het
Cubn A T 2: 13,491,695 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dpp8 A G 9: 65,078,109 probably null Het
Ecm1 G A 3: 95,735,857 T377I probably benign Het
Exosc8 A G 3: 54,731,179 probably benign Het
Fam129b G A 2: 32,920,982 V335M probably damaging Het
Fam71f1 G A 6: 29,319,298 E34K probably damaging Het
Fasn C T 11: 120,809,510 D2165N probably benign Het
Gab2 A G 7: 97,303,113 E571G probably damaging Het
Galnt5 C A 2: 57,999,625 H412Q probably benign Het
Galr1 T A 18: 82,405,864 Y96F possibly damaging Het
Gm8882 T C 6: 132,361,856 N133S unknown Het
Gnl2 C A 4: 125,055,365 probably benign Het
H2afx T C 9: 44,335,105 V115A probably benign Het
Heatr9 T C 11: 83,514,766 N317S possibly damaging Het
Hist1h2an A C 13: 21,786,911 I103S probably damaging Het
Kndc1 A G 7: 139,927,891 Y1254C probably damaging Het
Lrp6 A T 6: 134,459,296 D1302E probably benign Het
Mc2r A T 18: 68,407,948 Y91* probably null Het
Meis1 T G 11: 18,941,747 D267A possibly damaging Het
Mki67 T C 7: 135,699,981 K1108R possibly damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myh3 T G 11: 67,084,089 D219E probably damaging Het
Olfr1511 T C 14: 52,390,627 I49V probably damaging Het
Olfr857 T C 9: 19,713,274 L149P possibly damaging Het
Pi4ka A G 16: 17,293,953 C1553R probably damaging Het
Plekhb1 C A 7: 100,644,943 probably null Het
Polr3d A T 14: 70,440,759 D165E possibly damaging Het
Rab11fip5 A G 6: 85,374,137 L131P probably damaging Het
Raph1 A T 1: 60,493,498 probably benign Het
Scgb2b27 T G 7: 34,012,059 probably benign Het
Serpina10 T C 12: 103,626,661 D264G probably damaging Het
Sftpb A G 6: 72,304,667 T15A possibly damaging Het
Slc20a1 T C 2: 129,210,819 F674L probably benign Het
Syne2 A T 12: 75,938,721 N1648Y probably benign Het
Thsd7a G T 6: 12,332,017 N1265K possibly damaging Het
Trem2 T C 17: 48,351,774 L189P probably benign Het
Washc4 A T 10: 83,581,337 R865S probably damaging Het
Zfp536 A G 7: 37,568,792 S400P probably damaging Het
Other mutations in Psmb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02227:Psmb1 APN 17 15490284 start codon destroyed probably null 0.21
R0416:Psmb1 UTSW 17 15494519 missense probably benign 0.00
R3908:Psmb1 UTSW 17 15490281 missense probably damaging 1.00
R4946:Psmb1 UTSW 17 15498216 missense probably benign 0.01
R4976:Psmb1 UTSW 17 15498262 start codon destroyed probably null 0.99
R4979:Psmb1 UTSW 17 15476189 missense probably benign 0.23
R5119:Psmb1 UTSW 17 15498262 start codon destroyed probably null 0.99
R5939:Psmb1 UTSW 17 15498178 missense probably damaging 1.00
R6848:Psmb1 UTSW 17 15477247 missense probably benign 0.03
R7178:Psmb1 UTSW 17 15477259 missense possibly damaging 0.50
R7701:Psmb1 UTSW 17 15477247 missense probably benign 0.03
R7891:Psmb1 UTSW 17 15494486 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCTTGCTGTATGTCACTGAG -3'
(R):5'- GTACTGGTTGTTACTGAAGCTTGAC -3'

Sequencing Primer
(F):5'- CTGTATGTCACTGAGTGGTATTTATC -3'
(R):5'- GTTACTGAAGCTTGACAGATTCTG -3'
Posted On2016-10-05