Incidental Mutation 'R5506:3110002H16Rik'
ID430948
Institutional Source Beutler Lab
Gene Symbol 3110002H16Rik
Ensembl Gene ENSMUSG00000024410
Gene NameRIKEN cDNA 3110002H16 gene
Synonyms
MMRRC Submission 043067-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.793) question?
Stock #R5506 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location12168717-12189997 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 12188956 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121414 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025276] [ENSMUST00000025279] [ENSMUST00000134046] [ENSMUST00000138866]
Predicted Effect probably benign
Transcript: ENSMUST00000025276
SMART Domains Protein: ENSMUSP00000025276
Gene: ENSMUSG00000024410

DomainStartEndE-ValueType
SCOP:d1crza1 21 169 5e-4 SMART
low complexity region 268 281 N/A INTRINSIC
Pfam:Mic1 475 632 4.4e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025279
SMART Domains Protein: ENSMUSP00000025279
Gene: ENSMUSG00000024413

DomainStartEndE-ValueType
low complexity region 8 15 N/A INTRINSIC
Pfam:NPC1_N 22 267 1.6e-79 PFAM
transmembrane domain 269 291 N/A INTRINSIC
transmembrane domain 353 375 N/A INTRINSIC
Pfam:Patched 436 896 3.5e-52 PFAM
Pfam:MMPL 648 794 6.3e-8 PFAM
Pfam:Sterol-sensing 649 803 2.7e-56 PFAM
Pfam:Patched 1023 1252 2.9e-33 PFAM
low complexity region 1259 1273 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127123
Predicted Effect probably benign
Transcript: ENSMUST00000134046
SMART Domains Protein: ENSMUSP00000118783
Gene: ENSMUSG00000024410

DomainStartEndE-ValueType
low complexity region 58 71 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134756
Predicted Effect probably benign
Transcript: ENSMUST00000138866
SMART Domains Protein: ENSMUSP00000121414
Gene: ENSMUSG00000024410

DomainStartEndE-ValueType
low complexity region 37 50 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139151
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153233
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153352
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a colon cancer associated protein. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,067,947 G966W probably damaging Het
A930009A15Rik G T 10: 115,578,362 probably null Het
Cant1 G T 11: 118,411,442 H16Q probably benign Het
Capn3 G T 2: 120,502,420 V612F probably damaging Het
Cep112 A T 11: 108,664,603 E141D probably damaging Het
Cept1 A G 3: 106,531,248 V173A probably benign Het
CN725425 A G 15: 91,235,826 D50G possibly damaging Het
Cubn A T 2: 13,491,695 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dpp8 A G 9: 65,078,109 probably null Het
Ecm1 G A 3: 95,735,857 T377I probably benign Het
Exosc8 A G 3: 54,731,179 probably benign Het
Fam129b G A 2: 32,920,982 V335M probably damaging Het
Fam71f1 G A 6: 29,319,298 E34K probably damaging Het
Fasn C T 11: 120,809,510 D2165N probably benign Het
Gab2 A G 7: 97,303,113 E571G probably damaging Het
Galnt5 C A 2: 57,999,625 H412Q probably benign Het
Galr1 T A 18: 82,405,864 Y96F possibly damaging Het
Gm8882 T C 6: 132,361,856 N133S unknown Het
Gnl2 C A 4: 125,055,365 probably benign Het
H2afx T C 9: 44,335,105 V115A probably benign Het
Heatr9 T C 11: 83,514,766 N317S possibly damaging Het
Hist1h2an A C 13: 21,786,911 I103S probably damaging Het
Kndc1 A G 7: 139,927,891 Y1254C probably damaging Het
Lrp6 A T 6: 134,459,296 D1302E probably benign Het
Mc2r A T 18: 68,407,948 Y91* probably null Het
Meis1 T G 11: 18,941,747 D267A possibly damaging Het
Mki67 T C 7: 135,699,981 K1108R possibly damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myh3 T G 11: 67,084,089 D219E probably damaging Het
Olfr1511 T C 14: 52,390,627 I49V probably damaging Het
Olfr857 T C 9: 19,713,274 L149P possibly damaging Het
Pi4ka A G 16: 17,293,953 C1553R probably damaging Het
Plekhb1 C A 7: 100,644,943 probably null Het
Polr3d A T 14: 70,440,759 D165E possibly damaging Het
Psmb1 A G 17: 15,490,216 Y24H probably damaging Het
Rab11fip5 A G 6: 85,374,137 L131P probably damaging Het
Raph1 A T 1: 60,493,498 probably benign Het
Scgb2b27 T G 7: 34,012,059 probably benign Het
Serpina10 T C 12: 103,626,661 D264G probably damaging Het
Sftpb A G 6: 72,304,667 T15A possibly damaging Het
Slc20a1 T C 2: 129,210,819 F674L probably benign Het
Syne2 A T 12: 75,938,721 N1648Y probably benign Het
Thsd7a G T 6: 12,332,017 N1265K possibly damaging Het
Trem2 T C 17: 48,351,774 L189P probably benign Het
Washc4 A T 10: 83,581,337 R865S probably damaging Het
Zfp536 A G 7: 37,568,792 S400P probably damaging Het
Other mutations in 3110002H16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:3110002H16Rik APN 18 12179219 missense probably benign 0.00
IGL01883:3110002H16Rik APN 18 12178239 missense probably benign 0.03
IGL01956:3110002H16Rik APN 18 12189350 missense probably damaging 0.99
IGL02828:3110002H16Rik APN 18 12189221 missense possibly damaging 0.52
IGL03147:3110002H16Rik APN 18 12169229 splice site probably benign
R0147:3110002H16Rik UTSW 18 12189271 missense probably damaging 0.99
R0357:3110002H16Rik UTSW 18 12179209 missense possibly damaging 0.87
R1108:3110002H16Rik UTSW 18 12181623 missense probably damaging 0.99
R1422:3110002H16Rik UTSW 18 12181623 missense probably damaging 0.99
R1939:3110002H16Rik UTSW 18 12180505 missense probably damaging 1.00
R4300:3110002H16Rik UTSW 18 12188862 missense probably benign 0.00
R4826:3110002H16Rik UTSW 18 12185779 intron probably benign
R5103:3110002H16Rik UTSW 18 12189262 missense probably benign
R5345:3110002H16Rik UTSW 18 12179177 missense probably benign
R5566:3110002H16Rik UTSW 18 12180692 missense possibly damaging 0.90
R5574:3110002H16Rik UTSW 18 12185006 frame shift probably null
R5632:3110002H16Rik UTSW 18 12171583 missense possibly damaging 0.63
R6331:3110002H16Rik UTSW 18 12180514 missense probably damaging 0.99
R6765:3110002H16Rik UTSW 18 12176146 missense possibly damaging 0.82
R6978:3110002H16Rik UTSW 18 12185747 missense probably benign
R7310:3110002H16Rik UTSW 18 12184915 missense probably benign 0.13
R7734:3110002H16Rik UTSW 18 12189263 missense possibly damaging 0.81
R7792:3110002H16Rik UTSW 18 12181599 missense probably damaging 1.00
R7830:3110002H16Rik UTSW 18 12168871 missense probably benign 0.16
R7885:3110002H16Rik UTSW 18 12189314 missense probably damaging 1.00
R8047:3110002H16Rik UTSW 18 12180529 missense possibly damaging 0.67
R8144:3110002H16Rik UTSW 18 12185647 critical splice acceptor site probably null
R8157:3110002H16Rik UTSW 18 12188633 missense possibly damaging 0.95
X0062:3110002H16Rik UTSW 18 12179519 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTTGGTTCTCAGTGGGAACG -3'
(R):5'- TGCTGTTGAAAGTCTCTGGAAG -3'

Sequencing Primer
(F):5'- AGCCATGGTCCAGTGACTCAG -3'
(R):5'- TGTTGAAAGTCTCTGGAAGTAAGAAG -3'
Posted On2016-10-05