Incidental Mutation 'R5506:Mc2r'
List |< first << previous [record 27 of 48] next >> last >|
ID430949
Institutional Source Beutler Lab
Gene Symbol Mc2r
Ensembl Gene ENSMUSG00000045569
Gene Namemelanocortin 2 receptor
Synonymsadrenocorticotropic hormone receptor, Acthr
MMRRC Submission 043067-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5506 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location68406907-68429251 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 68407948 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 91 (Y91*)
Ref Sequence ENSEMBL: ENSMUSP00000058691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052347]
Predicted Effect probably null
Transcript: ENSMUST00000052347
AA Change: Y91*
SMART Domains Protein: ENSMUSP00000058691
Gene: ENSMUSG00000045569
AA Change: Y91*

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 291 2.4e-13 PFAM
Pfam:7tm_1 41 276 1.1e-29 PFAM
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MC2R encodes one member of the five-member G-protein associated melanocortin receptor family. Melanocortins (melanocyte-stimulating hormones and adrenocorticotropic hormone) are peptides derived from pro-opiomelanocortin (POMC). MC2R is selectively activated by adrenocorticotropic hormone, whereas the other four melanocortin receptors recognize a variety of melanocortin ligands. Mutations in MC2R can result in familial glucocorticoid deficiency. Alternate transcript variants have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality due to impaired gluconeogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,067,947 G966W probably damaging Het
3110002H16Rik A G 18: 12,188,956 probably benign Het
A930009A15Rik G T 10: 115,578,362 probably null Het
Cant1 G T 11: 118,411,442 H16Q probably benign Het
Capn3 G T 2: 120,502,420 V612F probably damaging Het
Cep112 A T 11: 108,664,603 E141D probably damaging Het
Cept1 A G 3: 106,531,248 V173A probably benign Het
CN725425 A G 15: 91,235,826 D50G possibly damaging Het
Cubn A T 2: 13,491,695 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dpp8 A G 9: 65,078,109 probably null Het
Ecm1 G A 3: 95,735,857 T377I probably benign Het
Exosc8 A G 3: 54,731,179 probably benign Het
Fam129b G A 2: 32,920,982 V335M probably damaging Het
Fam71f1 G A 6: 29,319,298 E34K probably damaging Het
Fasn C T 11: 120,809,510 D2165N probably benign Het
Gab2 A G 7: 97,303,113 E571G probably damaging Het
Galnt5 C A 2: 57,999,625 H412Q probably benign Het
Galr1 T A 18: 82,405,864 Y96F possibly damaging Het
Gm8882 T C 6: 132,361,856 N133S unknown Het
Gnl2 C A 4: 125,055,365 probably benign Het
H2afx T C 9: 44,335,105 V115A probably benign Het
Heatr9 T C 11: 83,514,766 N317S possibly damaging Het
Hist1h2an A C 13: 21,786,911 I103S probably damaging Het
Kndc1 A G 7: 139,927,891 Y1254C probably damaging Het
Lrp6 A T 6: 134,459,296 D1302E probably benign Het
Meis1 T G 11: 18,941,747 D267A possibly damaging Het
Mki67 T C 7: 135,699,981 K1108R possibly damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myh3 T G 11: 67,084,089 D219E probably damaging Het
Olfr1511 T C 14: 52,390,627 I49V probably damaging Het
Olfr857 T C 9: 19,713,274 L149P possibly damaging Het
Pi4ka A G 16: 17,293,953 C1553R probably damaging Het
Plekhb1 C A 7: 100,644,943 probably null Het
Polr3d A T 14: 70,440,759 D165E possibly damaging Het
Psmb1 A G 17: 15,490,216 Y24H probably damaging Het
Rab11fip5 A G 6: 85,374,137 L131P probably damaging Het
Raph1 A T 1: 60,493,498 probably benign Het
Scgb2b27 T G 7: 34,012,059 probably benign Het
Serpina10 T C 12: 103,626,661 D264G probably damaging Het
Sftpb A G 6: 72,304,667 T15A possibly damaging Het
Slc20a1 T C 2: 129,210,819 F674L probably benign Het
Syne2 A T 12: 75,938,721 N1648Y probably benign Het
Thsd7a G T 6: 12,332,017 N1265K possibly damaging Het
Trem2 T C 17: 48,351,774 L189P probably benign Het
Washc4 A T 10: 83,581,337 R865S probably damaging Het
Zfp536 A G 7: 37,568,792 S400P probably damaging Het
Other mutations in Mc2r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01654:Mc2r APN 18 68408072 missense probably benign 0.07
IGL01866:Mc2r APN 18 68407423 missense possibly damaging 0.81
IGL02002:Mc2r APN 18 68407434 missense probably benign 0.00
PIT4366001:Mc2r UTSW 18 68407755 missense probably benign
R0276:Mc2r UTSW 18 68408132 missense possibly damaging 0.69
R1061:Mc2r UTSW 18 68407809 missense probably damaging 1.00
R1085:Mc2r UTSW 18 68407346 missense probably benign
R1610:Mc2r UTSW 18 68407448 missense probably damaging 1.00
R1688:Mc2r UTSW 18 68408019 missense possibly damaging 0.68
R1930:Mc2r UTSW 18 68407782 missense probably benign 0.00
R2184:Mc2r UTSW 18 68408125 missense probably benign 0.02
R2397:Mc2r UTSW 18 68408153 missense probably benign 0.00
R4913:Mc2r UTSW 18 68407340 missense probably benign
R5087:Mc2r UTSW 18 68408203 missense probably benign 0.01
R5781:Mc2r UTSW 18 68407395 missense possibly damaging 0.69
R5781:Mc2r UTSW 18 68407397 missense probably damaging 1.00
R6364:Mc2r UTSW 18 68407536 missense probably benign 0.00
R7908:Mc2r UTSW 18 68407965 missense probably benign 0.00
Z1177:Mc2r UTSW 18 68407712 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TCCCTGTGCAGAACATCCAG -3'
(R):5'- TGTCCTGATGTAGTTTTGCCAGAAG -3'

Sequencing Primer
(F):5'- CCTGTGCAGAACATCCAGATAATTG -3'
(R):5'- TGCCAGAAGAGATATTTTTCACAATC -3'
Posted On2016-10-05