Incidental Mutation 'R5506:Galr1'
List |< first << previous [record 19 of 48] next >> last >|
ID430950
Institutional Source Beutler Lab
Gene Symbol Galr1
Ensembl Gene ENSMUSG00000024553
Gene Namegalanin receptor 1
SynonymsGalnr1
MMRRC Submission 043067-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5506 (G1)
Quality Score190
Status Validated
Chromosome18
Chromosomal Location82392496-82406777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82405864 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 96 (Y96F)
Ref Sequence ENSEMBL: ENSMUSP00000066381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065224]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065224
AA Change: Y96F

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000066381
Gene: ENSMUSG00000024553
AA Change: Y96F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srw 38 320 3e-8 PFAM
Pfam:7TM_GPCR_Srsx 44 317 1.5e-11 PFAM
Pfam:7tm_1 50 302 3.6e-56 PFAM
Pfam:7TM_GPCR_Srv 53 319 1.2e-7 PFAM
Meta Mutation Damage Score 0.1387 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The neuropeptide galanin elicits a range of biological effects by interaction with specific G-protein-coupled receptors. Galanin receptors are seven-transmembrane proteins shown to activate a variety of intracellular second-messenger pathways. GALR1 inhibits adenylyl cyclase via a G protein of the Gi/Go family. GALR1 is widely expressed in the brain and spinal cord, as well as in peripheral sites such as the small intestine and heart. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,067,947 G966W probably damaging Het
3110002H16Rik A G 18: 12,188,956 probably benign Het
A930009A15Rik G T 10: 115,578,362 probably null Het
Cant1 G T 11: 118,411,442 H16Q probably benign Het
Capn3 G T 2: 120,502,420 V612F probably damaging Het
Cep112 A T 11: 108,664,603 E141D probably damaging Het
Cept1 A G 3: 106,531,248 V173A probably benign Het
CN725425 A G 15: 91,235,826 D50G possibly damaging Het
Cubn A T 2: 13,491,695 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dpp8 A G 9: 65,078,109 probably null Het
Ecm1 G A 3: 95,735,857 T377I probably benign Het
Exosc8 A G 3: 54,731,179 probably benign Het
Fam129b G A 2: 32,920,982 V335M probably damaging Het
Fam71f1 G A 6: 29,319,298 E34K probably damaging Het
Fasn C T 11: 120,809,510 D2165N probably benign Het
Gab2 A G 7: 97,303,113 E571G probably damaging Het
Galnt5 C A 2: 57,999,625 H412Q probably benign Het
Gm8882 T C 6: 132,361,856 N133S unknown Het
Gnl2 C A 4: 125,055,365 probably benign Het
H2afx T C 9: 44,335,105 V115A probably benign Het
Heatr9 T C 11: 83,514,766 N317S possibly damaging Het
Hist1h2an A C 13: 21,786,911 I103S probably damaging Het
Kndc1 A G 7: 139,927,891 Y1254C probably damaging Het
Lrp6 A T 6: 134,459,296 D1302E probably benign Het
Mc2r A T 18: 68,407,948 Y91* probably null Het
Meis1 T G 11: 18,941,747 D267A possibly damaging Het
Mki67 T C 7: 135,699,981 K1108R possibly damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myh3 T G 11: 67,084,089 D219E probably damaging Het
Olfr1511 T C 14: 52,390,627 I49V probably damaging Het
Olfr857 T C 9: 19,713,274 L149P possibly damaging Het
Pi4ka A G 16: 17,293,953 C1553R probably damaging Het
Plekhb1 C A 7: 100,644,943 probably null Het
Polr3d A T 14: 70,440,759 D165E possibly damaging Het
Psmb1 A G 17: 15,490,216 Y24H probably damaging Het
Rab11fip5 A G 6: 85,374,137 L131P probably damaging Het
Raph1 A T 1: 60,493,498 probably benign Het
Scgb2b27 T G 7: 34,012,059 probably benign Het
Serpina10 T C 12: 103,626,661 D264G probably damaging Het
Sftpb A G 6: 72,304,667 T15A possibly damaging Het
Slc20a1 T C 2: 129,210,819 F674L probably benign Het
Syne2 A T 12: 75,938,721 N1648Y probably benign Het
Thsd7a G T 6: 12,332,017 N1265K possibly damaging Het
Trem2 T C 17: 48,351,774 L189P probably benign Het
Washc4 A T 10: 83,581,337 R865S probably damaging Het
Zfp536 A G 7: 37,568,792 S400P probably damaging Het
Other mutations in Galr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01992:Galr1 APN 18 82393817 missense probably damaging 1.00
IGL02047:Galr1 APN 18 82405993 missense probably damaging 1.00
IGL02985:Galr1 APN 18 82393730 missense probably benign 0.00
R0147:Galr1 UTSW 18 82405570 missense probably benign 0.01
R0148:Galr1 UTSW 18 82405570 missense probably benign 0.01
R0417:Galr1 UTSW 18 82405540 missense probably damaging 1.00
R1080:Galr1 UTSW 18 82405507 missense probably damaging 1.00
R1481:Galr1 UTSW 18 82405741 missense possibly damaging 0.82
R2422:Galr1 UTSW 18 82405923 missense probably damaging 1.00
R4896:Galr1 UTSW 18 82393940 missense probably damaging 1.00
R5219:Galr1 UTSW 18 82393985 missense probably damaging 1.00
R5272:Galr1 UTSW 18 82405636 missense probably benign 0.06
R5870:Galr1 UTSW 18 82406072 missense probably benign 0.00
R5900:Galr1 UTSW 18 82393857 missense probably damaging 1.00
R7229:Galr1 UTSW 18 82405664 missense probably damaging 1.00
R7408:Galr1 UTSW 18 82393865 missense probably damaging 1.00
R7897:Galr1 UTSW 18 82406131 missense probably benign 0.06
Z1177:Galr1 UTSW 18 82405772 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCCGATGGAAAAGACGCTG -3'
(R):5'- TGGAGAACTTCATTACGCTGG -3'

Sequencing Primer
(F):5'- ATGGACAGCGCCCAGATG -3'
(R):5'- AGAACTTCATTACGCTGGTAGTG -3'
Posted On2016-10-05