Mutagenetix > Incidental Mutations

Incidental Mutation 'R5507:Serpinb13'

430952

Institutional Source

Beutler Lab

Gene Symbol

Serpinb13

Ensembl Gene

ENSMUSG00000048775

Gene Name

serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 13

Synonyms

HURPIN, headpin, HUR7, PI13

MMRRC Submission

043068-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.063) question?

Stock #

R5507 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

106980984-107001195 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 106998602 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 169 (N169S)

Ref Sequence

ENSEMBL: ENSMUSP00000027564 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027564] [ENSMUST00000136766]

AlphaFold

Q8CDC0

Predicted Effect

probably benign
Transcript: ENSMUST00000027564
AA Change: N169S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000027564
Gene: ENSMUSG00000048775
AA Change: N169S

Domain	Start	End	E-Value	Type
SERPIN	13	389	1.55e-144	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000136766

SMART Domains

Protein: ENSMUSP00000118572
Gene: ENSMUSG00000048775

Domain	Start	End	E-Value	Type
Pfam:Serpin	6	94	1.1e-16	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.3%
3x: 97.3%
10x: 95.3%
20x: 91.2%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin family of serine protease inhibitors. The encoded protein inhibits the activity of cathepsin K and is itself transcriptionally repressed by RUNX1. This gene is downregulated in many types of cancer. [provided by RefSeq, Jan 2017]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700009N14Rik	A	G	4: 39,451,084	T97A	probably damaging	Het
1700017N19Rik	T	C	10: 100,609,233	S27P	probably benign	Het
Acoxl	C	A	2: 127,884,474	A256E	probably damaging	Het
Akap9	A	G	5: 3,968,683	E1088G	probably benign	Het
Alox12	T	C	11: 70,254,412	T112A	possibly damaging	Het
Ampd2	A	G	3: 108,077,613	V379A	probably damaging	Het
Ap4e1	C	A	2: 127,008,898	H49N	probably damaging	Het
Arhgap11a	T	C	2: 113,841,678	T260A	probably benign	Het
Atg2a	T	C	19: 6,245,070	F171S	possibly damaging	Het
Bpifb9b	A	T	2: 154,317,027	Y488F	possibly damaging	Het
C2cd2	T	C	16: 97,881,620	T139A	probably benign	Het
Cct8l1	A	T	5: 25,516,379	T31S	probably benign	Het
Cdhr1	A	T	14: 37,082,845	N469K	probably damaging	Het
Chga	T	C	12: 102,562,609	S282P	probably benign	Het
Chrnb4	T	G	9: 55,035,012	H326P	probably damaging	Het
Cntnap1	A	G	11: 101,183,477	T748A	probably benign	Het
Cpsf3	T	A	12: 21,297,928	L250H	probably damaging	Het
Dnajb12	GC	G	10: 59,892,752		probably null	Het
Dppa5a	T	A	9: 78,368,071	D10V	possibly damaging	Het
Dsc2	G	A	18: 20,046,279	T244I	probably damaging	Het
Elavl4	T	C	4: 110,213,206	T144A	probably benign	Het
Ephb1	C	T	9: 101,936,116	V776M	probably damaging	Het
Fcrl1	C	T	3: 87,391,242	S348F	probably benign	Het
Fga	T	A	3: 83,033,336	W766R	probably damaging	Het
Galnt14	A	G	17: 73,495,666	V477A	probably damaging	Het
Gcdh	A	G	8: 84,892,857	L103P	probably damaging	Het
Gm27013	G	A	6: 130,675,979	T840I	probably damaging	Het
Gpr179	A	T	11: 97,338,330	W1000R	probably damaging	Het
Hectd4	C	T	5: 121,281,101	A581V	unknown	Het
Ints12	T	A	3: 133,109,160	V376E	probably damaging	Het
Krt77	T	C	15: 101,861,230	I402V	probably benign	Het
March1	T	C	8: 66,418,890	V102A	probably damaging	Het
Meis1	A	T	11: 19,016,168	N68K	probably benign	Het
Mthfd1l	A	G	10: 4,106,432	E916G	probably benign	Het
Muc5ac	T	C	7: 141,807,832	F1627L	possibly damaging	Het
Myef2	A	T	2: 125,116,703	M102K	probably benign	Het
Naip6	A	C	13: 100,298,915	H1033Q	probably benign	Het
Nid1	T	A	13: 13,489,037	C760*	probably null	Het
Nt5dc1	A	T	10: 34,397,230	C191S	probably benign	Het
Nup214	A	G	2: 31,988,176	E285G	possibly damaging	Het
Nvl	A	G	1: 181,135,036	L123P	probably damaging	Het
Olfr1094	T	A	2: 86,829,317	H188Q	probably damaging	Het
Otog	A	G	7: 46,261,699	E658G	probably damaging	Het
Pam16	G	T	16: 4,618,016		probably benign	Het
Psg17	T	C	7: 18,819,926	D133G	probably benign	Het
Rabgap1l	A	G	1: 160,351,328	S21P	possibly damaging	Het
Rgs22	T	A	15: 36,099,652	M306L	probably damaging	Het
Ruvbl1	A	G	6: 88,467,600	K59R	probably benign	Het
Samd9l	T	C	6: 3,373,898	E1121G	possibly damaging	Het
Setbp1	T	A	18: 79,086,712	T102S	probably damaging	Het
Syn3	A	T	10: 86,080,226	S299T	probably benign	Het
Taar7a	A	G	10: 23,992,631	L284P	probably damaging	Het
Tlr6	C	A	5: 64,953,406	Q719H	probably damaging	Het
Tmem131	T	A	1: 36,889,280	D76V	probably damaging	Het
Tradd	T	G	8: 105,259,625	D145A	possibly damaging	Het
Usp20	A	T	2: 31,010,226	M251L	probably benign	Het
Vmn2r96	T	A	17: 18,597,829	L556Q	probably damaging	Het
Xrcc2	A	G	5: 25,692,319	S211P	probably benign	Het

Other mutations in Serpinb13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00558:Serpinb13	APN	1	106996380	missense	probably damaging	1.00
IGL01758:Serpinb13	APN	1	107000754	missense	probably damaging	1.00
IGL02078:Serpinb13	APN	1	106998958	missense	probably damaging	0.99
IGL02183:Serpinb13	APN	1	106998910	missense	probably damaging	1.00
PIT4651001:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R0683:Serpinb13	UTSW	1	106999021	missense	probably damaging	1.00
R1263:Serpinb13	UTSW	1	107000736	missense	probably damaging	0.97
R1535:Serpinb13	UTSW	1	106982156	start codon destroyed	probably null	1.00
R1929:Serpinb13	UTSW	1	106999026	missense	possibly damaging	0.85
R2271:Serpinb13	UTSW	1	106999026	missense	possibly damaging	0.85
R2655:Serpinb13	UTSW	1	107000427	missense	probably damaging	0.99
R3115:Serpinb13	UTSW	1	106982838	missense	probably null	0.15
R3418:Serpinb13	UTSW	1	106998927	missense	probably damaging	0.99
R3419:Serpinb13	UTSW	1	106998927	missense	probably damaging	0.99
R3883:Serpinb13	UTSW	1	106998572	missense	probably benign	0.37
R4664:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4666:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4689:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4690:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4725:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4728:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4847:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R5249:Serpinb13	UTSW	1	106998697	missense	probably damaging	1.00
R5501:Serpinb13	UTSW	1	106982185	missense	possibly damaging	0.81
R6015:Serpinb13	UTSW	1	107000607	missense	probably benign	0.00
R6363:Serpinb13	UTSW	1	107000774	nonsense	probably null
R6720:Serpinb13	UTSW	1	106994062	missense	probably benign	0.12
R6847:Serpinb13	UTSW	1	106998933	missense	probably benign	0.24
R7237:Serpinb13	UTSW	1	106998949	missense	probably damaging	1.00
R8907:Serpinb13	UTSW	1	107000789	missense	probably damaging	1.00
R8966:Serpinb13	UTSW	1	107000435	missense	probably damaging	1.00
R9011:Serpinb13	UTSW	1	106995789	missense	probably benign	0.01
R9350:Serpinb13	UTSW	1	106995832	nonsense	probably null
R9375:Serpinb13	UTSW	1	106982267	missense	probably damaging	1.00
Z1177:Serpinb13	UTSW	1	106982303	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- AGTATGAGAAAGTCCCCACTGAC -3'
(R):5'- GTGGCAAAAGTCTGAGTAACTG -3'

Sequencing Primer
(F):5'- TGACCCTTGGTGAGCAAGG -3'
(R):5'- CTGAGTAACTGAATAATCACTTGGCC -3'

Posted On

2016-10-05