Incidental Mutation 'R5507:Nvl'
ID430955
Institutional Source Beutler Lab
Gene Symbol Nvl
Ensembl Gene ENSMUSG00000026516
Gene Namenuclear VCP-like
Synonyms1200009I24Rik
MMRRC Submission 043068-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R5507 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location181087138-181144204 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 181135036 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 123 (L123P)
Ref Sequence ENSEMBL: ENSMUSP00000027797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027797]
PDB Structure Structure and function of the N-terminal nucleolin binding domain of nuclear valocine containing protein like 2 (NVL2) harboring a nucleolar localization signal [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000027797
AA Change: L123P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027797
Gene: ENSMUSG00000026516
AA Change: L123P

DomainStartEndE-ValueType
Pfam:Nucleolin_bd 2 72 1.9e-31 PFAM
low complexity region 90 104 N/A INTRINSIC
low complexity region 187 201 N/A INTRINSIC
low complexity region 216 230 N/A INTRINSIC
AAA 296 435 2.94e-23 SMART
low complexity region 524 540 N/A INTRINSIC
AAA 613 749 2.56e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193758
Meta Mutation Damage Score 0.2657 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.2%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AAA (ATPases associated with diverse cellular activities) superfamily. Multiple transcript variants encoding different isoforms have been found for this gene. Two encoded proteins, described as major and minor isoforms, have been localized to distinct regions of the nucleus. The largest encoded protein (major isoform) has been localized to the nucleolus and shown to participate in ribosome biosynthesis (PMID: 15469983, 16782053), while the minor isoform has been localized to the nucleoplasmin. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A G 4: 39,451,084 T97A probably damaging Het
1700017N19Rik T C 10: 100,609,233 S27P probably benign Het
Acoxl C A 2: 127,884,474 A256E probably damaging Het
Akap9 A G 5: 3,968,683 E1088G probably benign Het
Alox12 T C 11: 70,254,412 T112A possibly damaging Het
Ampd2 A G 3: 108,077,613 V379A probably damaging Het
Ap4e1 C A 2: 127,008,898 H49N probably damaging Het
Arhgap11a T C 2: 113,841,678 T260A probably benign Het
Atg2a T C 19: 6,245,070 F171S possibly damaging Het
Bpifb9b A T 2: 154,317,027 Y488F possibly damaging Het
C2cd2 T C 16: 97,881,620 T139A probably benign Het
Cct8l1 A T 5: 25,516,379 T31S probably benign Het
Cdhr1 A T 14: 37,082,845 N469K probably damaging Het
Chga T C 12: 102,562,609 S282P probably benign Het
Chrnb4 T G 9: 55,035,012 H326P probably damaging Het
Cntnap1 A G 11: 101,183,477 T748A probably benign Het
Cpsf3 T A 12: 21,297,928 L250H probably damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dppa5a T A 9: 78,368,071 D10V possibly damaging Het
Dsc2 G A 18: 20,046,279 T244I probably damaging Het
Elavl4 T C 4: 110,213,206 T144A probably benign Het
Ephb1 C T 9: 101,936,116 V776M probably damaging Het
Fcrl1 C T 3: 87,391,242 S348F probably benign Het
Fga T A 3: 83,033,336 W766R probably damaging Het
Galnt14 A G 17: 73,495,666 V477A probably damaging Het
Gcdh A G 8: 84,892,857 L103P probably damaging Het
Gm27013 G A 6: 130,675,979 T840I probably damaging Het
Gpr179 A T 11: 97,338,330 W1000R probably damaging Het
Hectd4 C T 5: 121,281,101 A581V unknown Het
Ints12 T A 3: 133,109,160 V376E probably damaging Het
Krt77 T C 15: 101,861,230 I402V probably benign Het
March1 T C 8: 66,418,890 V102A probably damaging Het
Meis1 A T 11: 19,016,168 N68K probably benign Het
Mthfd1l A G 10: 4,106,432 E916G probably benign Het
Muc5ac T C 7: 141,807,832 F1627L possibly damaging Het
Myef2 A T 2: 125,116,703 M102K probably benign Het
Naip6 A C 13: 100,298,915 H1033Q probably benign Het
Nid1 T A 13: 13,489,037 C760* probably null Het
Nt5dc1 A T 10: 34,397,230 C191S probably benign Het
Nup214 A G 2: 31,988,176 E285G possibly damaging Het
Olfr1094 T A 2: 86,829,317 H188Q probably damaging Het
Otog A G 7: 46,261,699 E658G probably damaging Het
Pam16 G T 16: 4,618,016 probably benign Het
Psg17 T C 7: 18,819,926 D133G probably benign Het
Rabgap1l A G 1: 160,351,328 S21P possibly damaging Het
Rgs22 T A 15: 36,099,652 M306L probably damaging Het
Ruvbl1 A G 6: 88,467,600 K59R probably benign Het
Samd9l T C 6: 3,373,898 E1121G possibly damaging Het
Serpinb13 A G 1: 106,998,602 N169S probably benign Het
Setbp1 T A 18: 79,086,712 T102S probably damaging Het
Syn3 A T 10: 86,080,226 S299T probably benign Het
Taar7a A G 10: 23,992,631 L284P probably damaging Het
Tlr6 C A 5: 64,953,406 Q719H probably damaging Het
Tmem131 T A 1: 36,889,280 D76V probably damaging Het
Tradd T G 8: 105,259,625 D145A possibly damaging Het
Usp20 A T 2: 31,010,226 M251L probably benign Het
Vmn2r96 T A 17: 18,597,829 L556Q probably damaging Het
Xrcc2 A G 5: 25,692,319 S211P probably benign Het
Other mutations in Nvl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Nvl APN 1 181105125 missense probably damaging 1.00
IGL00943:Nvl APN 1 181101634 missense possibly damaging 0.72
IGL01956:Nvl APN 1 181134944 missense probably benign 0.00
IGL02657:Nvl APN 1 181106976 missense probably damaging 1.00
nineveh UTSW 1 181136906 missense probably benign 0.00
nubia UTSW 1 181112334 missense probably benign 0.19
IGL03098:Nvl UTSW 1 181093906 missense probably benign 0.37
P0047:Nvl UTSW 1 181112302 missense probably damaging 1.00
R0003:Nvl UTSW 1 181114133 missense probably damaging 1.00
R0114:Nvl UTSW 1 181120391 missense probably benign 0.19
R0265:Nvl UTSW 1 181134830 missense probably damaging 0.96
R0928:Nvl UTSW 1 181093902 missense probably benign 0.00
R1398:Nvl UTSW 1 181097126 splice site probably benign
R1470:Nvl UTSW 1 181139262 missense probably damaging 1.00
R1470:Nvl UTSW 1 181139262 missense probably damaging 1.00
R1529:Nvl UTSW 1 181109159 critical splice donor site probably null
R1934:Nvl UTSW 1 181099128 missense probably damaging 0.96
R2176:Nvl UTSW 1 181135074 splice site probably benign
R2351:Nvl UTSW 1 181130792 missense probably benign 0.03
R4415:Nvl UTSW 1 181105114 missense probably benign
R4570:Nvl UTSW 1 181144082 missense probably benign 0.03
R4720:Nvl UTSW 1 181101587 missense probably damaging 1.00
R4888:Nvl UTSW 1 181117626 missense probably damaging 1.00
R5026:Nvl UTSW 1 181105155 missense probably damaging 1.00
R5785:Nvl UTSW 1 181139298 missense probably damaging 1.00
R5983:Nvl UTSW 1 181136906 missense probably benign 0.00
R6143:Nvl UTSW 1 181134995 missense probably benign 0.01
R6532:Nvl UTSW 1 181144143 splice site probably null
R6821:Nvl UTSW 1 181126970 nonsense probably null
R7062:Nvl UTSW 1 181112334 missense probably benign 0.19
R7247:Nvl UTSW 1 181112286 critical splice donor site probably null
R7358:Nvl UTSW 1 181135036 missense probably damaging 0.98
R7665:Nvl UTSW 1 181134944 missense probably benign 0.18
R7795:Nvl UTSW 1 181097157 missense probably benign 0.00
R7931:Nvl UTSW 1 181109155 splice site probably benign
R8185:Nvl UTSW 1 181144174 unclassified probably benign
R8806:Nvl UTSW 1 181095054 missense probably benign 0.01
R8933:Nvl UTSW 1 181139073 missense probably benign 0.00
X0067:Nvl UTSW 1 181139158 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TTCCACCGGGAGTTTTGTC -3'
(R):5'- CATGGTTCTCTGTTAGCCAAGAG -3'

Sequencing Primer
(F):5'- CCGGGAGTTTTGTCAATAAACCATCC -3'
(R):5'- CCAAGAGTGGTTTAGTAGTTTCAG -3'
Posted On2016-10-05