Incidental Mutation 'R5507:Usp20'
ID 430956
Institutional Source Beutler Lab
Gene Symbol Usp20
Ensembl Gene ENSMUSG00000026854
Gene Name ubiquitin specific peptidase 20
Synonyms Vdu2, 1700055M05Rik
MMRRC Submission 043068-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5507 (G1)
Quality Score 140
Status Validated
Chromosome 2
Chromosomal Location 30872291-30912667 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 30900238 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 251 (M251L)
Ref Sequence ENSEMBL: ENSMUSP00000127388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061544] [ENSMUST00000102849] [ENSMUST00000170476]
AlphaFold Q8C6M1
Predicted Effect probably benign
Transcript: ENSMUST00000061544
SMART Domains Protein: ENSMUSP00000060167
Gene: ENSMUSG00000026854

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 3.2e-18 PFAM
low complexity region 128 138 N/A INTRINSIC
Pfam:UCH 144 210 2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102849
AA Change: M251L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099913
Gene: ENSMUSG00000026854
AA Change: M251L

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 4.3e-17 PFAM
low complexity region 128 138 N/A INTRINSIC
Pfam:UCH 144 684 5e-63 PFAM
Pfam:UCH_1 145 669 8.8e-24 PFAM
DUSP 704 787 5.97e-28 SMART
DUSP 812 897 4.74e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136588
SMART Domains Protein: ENSMUSP00000119197
Gene: ENSMUSG00000026854

DomainStartEndE-ValueType
Pfam:zf-UBP 10 60 6.4e-12 PFAM
low complexity region 93 103 N/A INTRINSIC
Pfam:UCH 109 142 4.6e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154351
Predicted Effect probably benign
Transcript: ENSMUST00000170476
AA Change: M251L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127388
Gene: ENSMUSG00000026854
AA Change: M251L

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 3.4e-17 PFAM
low complexity region 128 138 N/A INTRINSIC
Pfam:UCH 144 270 1.2e-26 PFAM
Pfam:UCH_1 145 669 6.1e-20 PFAM
Pfam:UCH 324 684 1.6e-31 PFAM
DUSP 704 787 5.97e-28 SMART
DUSP 812 897 4.74e-31 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.2%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin specific processing protease that was first identified as a substrate of the VHL (von Hippel-Lindau disease) protein E3 ubiquitin ligase complex. In addition to being ubiquitinated by the VHL-E3 ligase complex, this enzyme deubiquitinates hypoxia-inducible factor (HIF)-1 alpha and thereby causes increased expression of HIF-1alpha targeted genes which play a role in angiogenesis, glucose metabolism, cell proliferation and metastasis. The enzyme encoded by this gene also regulates G-protein coupled receptor signaling by mediating the deubiquitination of beta-2 adrenergic receptor (ADRB2). This enzyme is a ubiquitously expressed thiolester hydrolase. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A G 4: 39,451,084 (GRCm39) T97A probably damaging Het
1700017N19Rik T C 10: 100,445,095 (GRCm39) S27P probably benign Het
Acoxl C A 2: 127,726,394 (GRCm39) A256E probably damaging Het
Akap9 A G 5: 4,018,683 (GRCm39) E1088G probably benign Het
Alox12 T C 11: 70,145,238 (GRCm39) T112A possibly damaging Het
Ampd2 A G 3: 107,984,929 (GRCm39) V379A probably damaging Het
Ap4e1 C A 2: 126,850,818 (GRCm39) H49N probably damaging Het
Arhgap11a T C 2: 113,672,023 (GRCm39) T260A probably benign Het
Atg2a T C 19: 6,295,100 (GRCm39) F171S possibly damaging Het
Bpifb9b A T 2: 154,158,947 (GRCm39) Y488F possibly damaging Het
C2cd2 T C 16: 97,682,820 (GRCm39) T139A probably benign Het
Cct8l1 A T 5: 25,721,377 (GRCm39) T31S probably benign Het
Cdhr1 A T 14: 36,804,802 (GRCm39) N469K probably damaging Het
Chga T C 12: 102,528,868 (GRCm39) S282P probably benign Het
Chrnb4 T G 9: 54,942,296 (GRCm39) H326P probably damaging Het
Cntnap1 A G 11: 101,074,303 (GRCm39) T748A probably benign Het
Cpsf3 T A 12: 21,347,929 (GRCm39) L250H probably damaging Het
Dnajb12 GC G 10: 59,728,574 (GRCm39) probably null Het
Dppa5a T A 9: 78,275,353 (GRCm39) D10V possibly damaging Het
Dsc2 G A 18: 20,179,336 (GRCm39) T244I probably damaging Het
Elavl4 T C 4: 110,070,403 (GRCm39) T144A probably benign Het
Ephb1 C T 9: 101,813,315 (GRCm39) V776M probably damaging Het
Fcrl1 C T 3: 87,298,549 (GRCm39) S348F probably benign Het
Fga T A 3: 82,940,643 (GRCm39) W766R probably damaging Het
Galnt14 A G 17: 73,802,661 (GRCm39) V477A probably damaging Het
Gcdh A G 8: 85,619,486 (GRCm39) L103P probably damaging Het
Gm27013 G A 6: 130,652,942 (GRCm39) T840I probably damaging Het
Gpr179 A T 11: 97,229,156 (GRCm39) W1000R probably damaging Het
Hectd4 C T 5: 121,419,164 (GRCm39) A581V unknown Het
Ints12 T A 3: 132,814,921 (GRCm39) V376E probably damaging Het
Krt77 T C 15: 101,769,665 (GRCm39) I402V probably benign Het
Marchf1 T C 8: 66,871,542 (GRCm39) V102A probably damaging Het
Meis1 A T 11: 18,966,168 (GRCm39) N68K probably benign Het
Mthfd1l A G 10: 4,056,432 (GRCm39) E916G probably benign Het
Muc5ac T C 7: 141,361,569 (GRCm39) F1627L possibly damaging Het
Myef2 A T 2: 124,958,623 (GRCm39) M102K probably benign Het
Naip6 A C 13: 100,435,423 (GRCm39) H1033Q probably benign Het
Nid1 T A 13: 13,663,622 (GRCm39) C760* probably null Het
Nt5dc1 A T 10: 34,273,226 (GRCm39) C191S probably benign Het
Nup214 A G 2: 31,878,188 (GRCm39) E285G possibly damaging Het
Nvl A G 1: 180,962,601 (GRCm39) L123P probably damaging Het
Or5t9 T A 2: 86,659,661 (GRCm39) H188Q probably damaging Het
Otog A G 7: 45,911,123 (GRCm39) E658G probably damaging Het
Pam16 G T 16: 4,435,880 (GRCm39) probably benign Het
Psg17 T C 7: 18,553,851 (GRCm39) D133G probably benign Het
Rabgap1l A G 1: 160,178,898 (GRCm39) S21P possibly damaging Het
Rgs22 T A 15: 36,099,798 (GRCm39) M306L probably damaging Het
Ruvbl1 A G 6: 88,444,582 (GRCm39) K59R probably benign Het
Samd9l T C 6: 3,373,898 (GRCm39) E1121G possibly damaging Het
Serpinb13 A G 1: 106,926,332 (GRCm39) N169S probably benign Het
Setbp1 T A 18: 79,129,927 (GRCm39) T102S probably damaging Het
Syn3 A T 10: 85,916,090 (GRCm39) S299T probably benign Het
Taar7a A G 10: 23,868,529 (GRCm39) L284P probably damaging Het
Tlr6 C A 5: 65,110,749 (GRCm39) Q719H probably damaging Het
Tmem131 T A 1: 36,928,361 (GRCm39) D76V probably damaging Het
Tradd T G 8: 105,986,257 (GRCm39) D145A possibly damaging Het
Vmn2r96 T A 17: 18,818,091 (GRCm39) L556Q probably damaging Het
Xrcc2 A G 5: 25,897,317 (GRCm39) S211P probably benign Het
Other mutations in Usp20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Usp20 APN 2 30,894,962 (GRCm39) missense probably damaging 1.00
IGL01444:Usp20 APN 2 30,888,801 (GRCm39) start codon destroyed probably null 1.00
IGL01601:Usp20 APN 2 30,901,806 (GRCm39) missense probably benign 0.04
IGL01785:Usp20 APN 2 30,907,175 (GRCm39) missense probably benign 0.02
IGL01786:Usp20 APN 2 30,907,175 (GRCm39) missense probably benign 0.02
IGL02129:Usp20 APN 2 30,894,462 (GRCm39) missense probably benign 0.43
IGL02147:Usp20 APN 2 30,896,413 (GRCm39) missense probably damaging 1.00
IGL03396:Usp20 APN 2 30,901,729 (GRCm39) missense probably benign
BB007:Usp20 UTSW 2 30,900,556 (GRCm39) missense probably benign 0.21
BB017:Usp20 UTSW 2 30,900,556 (GRCm39) missense probably benign 0.21
PIT4453001:Usp20 UTSW 2 30,907,498 (GRCm39) missense possibly damaging 0.47
R0111:Usp20 UTSW 2 30,892,624 (GRCm39) missense probably damaging 1.00
R0369:Usp20 UTSW 2 30,901,116 (GRCm39) missense probably benign 0.00
R0479:Usp20 UTSW 2 30,907,487 (GRCm39) missense probably benign 0.18
R0538:Usp20 UTSW 2 30,894,462 (GRCm39) missense probably damaging 0.99
R1023:Usp20 UTSW 2 30,897,825 (GRCm39) missense probably damaging 1.00
R1183:Usp20 UTSW 2 30,901,797 (GRCm39) missense probably benign 0.17
R1635:Usp20 UTSW 2 30,908,830 (GRCm39) missense probably benign 0.03
R2114:Usp20 UTSW 2 30,906,317 (GRCm39) missense probably damaging 1.00
R2115:Usp20 UTSW 2 30,906,317 (GRCm39) missense probably damaging 1.00
R2116:Usp20 UTSW 2 30,906,317 (GRCm39) missense probably damaging 1.00
R2117:Usp20 UTSW 2 30,906,317 (GRCm39) missense probably damaging 1.00
R2232:Usp20 UTSW 2 30,908,750 (GRCm39) missense probably benign 0.13
R2244:Usp20 UTSW 2 30,900,343 (GRCm39) missense possibly damaging 0.65
R2883:Usp20 UTSW 2 30,908,812 (GRCm39) missense probably benign
R4734:Usp20 UTSW 2 30,909,836 (GRCm39) missense probably benign 0.31
R5770:Usp20 UTSW 2 30,907,520 (GRCm39) missense probably damaging 1.00
R5862:Usp20 UTSW 2 30,896,461 (GRCm39) nonsense probably null
R6315:Usp20 UTSW 2 30,907,770 (GRCm39) missense possibly damaging 0.70
R7603:Usp20 UTSW 2 30,901,486 (GRCm39) missense probably damaging 1.00
R7887:Usp20 UTSW 2 30,910,906 (GRCm39) missense probably benign 0.34
R7930:Usp20 UTSW 2 30,900,556 (GRCm39) missense probably benign 0.21
R8542:Usp20 UTSW 2 30,901,636 (GRCm39) missense possibly damaging 0.94
R8965:Usp20 UTSW 2 30,901,797 (GRCm39) missense possibly damaging 0.77
R9079:Usp20 UTSW 2 30,895,120 (GRCm39) intron probably benign
R9226:Usp20 UTSW 2 30,907,412 (GRCm39) missense probably damaging 0.99
R9417:Usp20 UTSW 2 30,873,030 (GRCm39) critical splice acceptor site probably null
R9459:Usp20 UTSW 2 30,901,024 (GRCm39) missense probably damaging 0.99
Z1176:Usp20 UTSW 2 30,909,830 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAGAACTATGGTGGAGACTGCTG -3'
(R):5'- TCCTTCTCAGAGATGGCTCG -3'

Sequencing Primer
(F):5'- ACTGCTGCAGGGGACTAAGC -3'
(R):5'- TGAGATCAGCAGCTCCATCTCG -3'
Posted On 2016-10-05