Incidental Mutation 'R5507:Bpifb9b'
ID430962
Institutional Source Beutler Lab
Gene Symbol Bpifb9b
Ensembl Gene ENSMUSG00000067996
Gene NameBPI fold containing family B, member 9B
SynonymsOTTMUSG00000015915, 5430413K10Rik
MMRRC Submission 043068-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R5507 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location154307227-154320646 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 154317027 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 488 (Y488F)
Ref Sequence ENSEMBL: ENSMUSP00000086311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088921]
Predicted Effect possibly damaging
Transcript: ENSMUST00000088921
AA Change: Y488F

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000086311
Gene: ENSMUSG00000067996
AA Change: Y488F

DomainStartEndE-ValueType
low complexity region 29 42 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 122 157 N/A INTRINSIC
low complexity region 167 181 N/A INTRINSIC
low complexity region 184 203 N/A INTRINSIC
Pfam:LBP_BPI_CETP 216 377 1.7e-11 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.2%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A G 4: 39,451,084 T97A probably damaging Het
1700017N19Rik T C 10: 100,609,233 S27P probably benign Het
Acoxl C A 2: 127,884,474 A256E probably damaging Het
Akap9 A G 5: 3,968,683 E1088G probably benign Het
Alox12 T C 11: 70,254,412 T112A possibly damaging Het
Ampd2 A G 3: 108,077,613 V379A probably damaging Het
Ap4e1 C A 2: 127,008,898 H49N probably damaging Het
Arhgap11a T C 2: 113,841,678 T260A probably benign Het
Atg2a T C 19: 6,245,070 F171S possibly damaging Het
C2cd2 T C 16: 97,881,620 T139A probably benign Het
Cct8l1 A T 5: 25,516,379 T31S probably benign Het
Cdhr1 A T 14: 37,082,845 N469K probably damaging Het
Chga T C 12: 102,562,609 S282P probably benign Het
Chrnb4 T G 9: 55,035,012 H326P probably damaging Het
Cntnap1 A G 11: 101,183,477 T748A probably benign Het
Cpsf3 T A 12: 21,297,928 L250H probably damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dppa5a T A 9: 78,368,071 D10V possibly damaging Het
Dsc2 G A 18: 20,046,279 T244I probably damaging Het
Elavl4 T C 4: 110,213,206 T144A probably benign Het
Ephb1 C T 9: 101,936,116 V776M probably damaging Het
Fcrl1 C T 3: 87,391,242 S348F probably benign Het
Fga T A 3: 83,033,336 W766R probably damaging Het
Galnt14 A G 17: 73,495,666 V477A probably damaging Het
Gcdh A G 8: 84,892,857 L103P probably damaging Het
Gm27013 G A 6: 130,675,979 T840I probably damaging Het
Gpr179 A T 11: 97,338,330 W1000R probably damaging Het
Hectd4 C T 5: 121,281,101 A581V unknown Het
Ints12 T A 3: 133,109,160 V376E probably damaging Het
Krt77 T C 15: 101,861,230 I402V probably benign Het
March1 T C 8: 66,418,890 V102A probably damaging Het
Meis1 A T 11: 19,016,168 N68K probably benign Het
Mthfd1l A G 10: 4,106,432 E916G probably benign Het
Muc5ac T C 7: 141,807,832 F1627L possibly damaging Het
Myef2 A T 2: 125,116,703 M102K probably benign Het
Naip6 A C 13: 100,298,915 H1033Q probably benign Het
Nid1 T A 13: 13,489,037 C760* probably null Het
Nt5dc1 A T 10: 34,397,230 C191S probably benign Het
Nup214 A G 2: 31,988,176 E285G possibly damaging Het
Nvl A G 1: 181,135,036 L123P probably damaging Het
Olfr1094 T A 2: 86,829,317 H188Q probably damaging Het
Otog A G 7: 46,261,699 E658G probably damaging Het
Pam16 G T 16: 4,618,016 probably benign Het
Psg17 T C 7: 18,819,926 D133G probably benign Het
Rabgap1l A G 1: 160,351,328 S21P possibly damaging Het
Rgs22 T A 15: 36,099,652 M306L probably damaging Het
Ruvbl1 A G 6: 88,467,600 K59R probably benign Het
Samd9l T C 6: 3,373,898 E1121G possibly damaging Het
Serpinb13 A G 1: 106,998,602 N169S probably benign Het
Setbp1 T A 18: 79,086,712 T102S probably damaging Het
Syn3 A T 10: 86,080,226 S299T probably benign Het
Taar7a A G 10: 23,992,631 L284P probably damaging Het
Tlr6 C A 5: 64,953,406 Q719H probably damaging Het
Tmem131 T A 1: 36,889,280 D76V probably damaging Het
Tradd T G 8: 105,259,625 D145A possibly damaging Het
Usp20 A T 2: 31,010,226 M251L probably benign Het
Vmn2r96 T A 17: 18,597,829 L556Q probably damaging Het
Xrcc2 A G 5: 25,692,319 S211P probably benign Het
Other mutations in Bpifb9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Bpifb9b APN 2 154316951 splice site probably null
IGL02119:Bpifb9b APN 2 154313624 missense possibly damaging 0.84
IGL02658:Bpifb9b APN 2 154311281 missense probably benign 0.00
R0230:Bpifb9b UTSW 2 154317075 missense probably damaging 1.00
R0269:Bpifb9b UTSW 2 154319625 missense probably benign 0.00
R0617:Bpifb9b UTSW 2 154319625 missense probably benign 0.00
R1953:Bpifb9b UTSW 2 154311314 missense probably damaging 0.99
R2050:Bpifb9b UTSW 2 154309604 missense possibly damaging 0.93
R2160:Bpifb9b UTSW 2 154319675 missense possibly damaging 0.53
R2200:Bpifb9b UTSW 2 154313654 missense probably benign 0.00
R2354:Bpifb9b UTSW 2 154311742 missense probably benign
R4755:Bpifb9b UTSW 2 154319694 missense probably benign 0.01
R4872:Bpifb9b UTSW 2 154313631 missense probably damaging 0.99
R4914:Bpifb9b UTSW 2 154314106 splice site probably null
R4915:Bpifb9b UTSW 2 154314106 splice site probably null
R4917:Bpifb9b UTSW 2 154314106 splice site probably null
R4918:Bpifb9b UTSW 2 154314106 splice site probably null
R4950:Bpifb9b UTSW 2 154311659 missense probably damaging 1.00
R5438:Bpifb9b UTSW 2 154309368 missense possibly damaging 0.65
R6255:Bpifb9b UTSW 2 154309364 missense probably damaging 0.98
R7130:Bpifb9b UTSW 2 154311672 missense probably damaging 0.98
R7161:Bpifb9b UTSW 2 154313615 missense possibly damaging 0.95
R7736:Bpifb9b UTSW 2 154312105 missense probably benign 0.00
R8536:Bpifb9b UTSW 2 154316277 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTACGAGCCAGAATGTAGTATG -3'
(R):5'- TCTTGCTGCCATGGGAGATG -3'

Sequencing Primer
(F):5'- CGAGCCAGAATGTAGTATGTTAACC -3'
(R):5'- GCTGCCATGGGAGATGAATAATTTC -3'
Posted On2016-10-05