Incidental Mutation 'R5507:Fga'
ID430963
Institutional Source Beutler Lab
Gene Symbol Fga
Ensembl Gene ENSMUSG00000028001
Gene Namefibrinogen alpha chain
SynonymsENSMUSG00000059807, Fib
MMRRC Submission 043068-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.407) question?
Stock #R5507 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location83026076-83033627 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83033336 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 766 (W766R)
Ref Sequence ENSEMBL: ENSMUSP00000133117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029630] [ENSMUST00000166581]
Predicted Effect probably benign
Transcript: ENSMUST00000029630
SMART Domains Protein: ENSMUSP00000029630
Gene: ENSMUSG00000028001

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
Fib_alpha 49 193 1.29e-69 SMART
low complexity region 264 286 N/A INTRINSIC
low complexity region 311 340 N/A INTRINSIC
Pfam:Fibrinogen_aC 392 458 1.6e-33 PFAM
low complexity region 500 522 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166581
AA Change: W766R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133117
Gene: ENSMUSG00000028001
AA Change: W766R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
Fib_alpha 49 193 1.29e-69 SMART
low complexity region 264 286 N/A INTRINSIC
low complexity region 311 340 N/A INTRINSIC
Pfam:Fibrinogen_aC 392 457 9.3e-34 PFAM
low complexity region 500 522 N/A INTRINSIC
FBG 550 786 1.43e-128 SMART
Meta Mutation Damage Score 0.9517 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.2%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: This gene encodes a subunit of the coagulation factor fibrinogen, which is a component of the blood clot. The encoded protein is proteolytically processed by thrombin during the conversion of fibrinogen to fibrin. Mice lacking the encoded protein display bleeding in the peritoneal cavity, skin and soft tissues around joints immediately after birth, and are predisposed to spontaneous fatal abdominal hemorrhage as they grow. Pregnant mice lacking the encoded protein succumb to uterine bleeding during gestation. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for disruptions of this gene have blood that is unable to clot. On some genetic backgrounds this can lead to fatal hemorrhaging. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A G 4: 39,451,084 T97A probably damaging Het
1700017N19Rik T C 10: 100,609,233 S27P probably benign Het
Acoxl C A 2: 127,884,474 A256E probably damaging Het
Akap9 A G 5: 3,968,683 E1088G probably benign Het
Alox12 T C 11: 70,254,412 T112A possibly damaging Het
Ampd2 A G 3: 108,077,613 V379A probably damaging Het
Ap4e1 C A 2: 127,008,898 H49N probably damaging Het
Arhgap11a T C 2: 113,841,678 T260A probably benign Het
Atg2a T C 19: 6,245,070 F171S possibly damaging Het
Bpifb9b A T 2: 154,317,027 Y488F possibly damaging Het
C2cd2 T C 16: 97,881,620 T139A probably benign Het
Cct8l1 A T 5: 25,516,379 T31S probably benign Het
Cdhr1 A T 14: 37,082,845 N469K probably damaging Het
Chga T C 12: 102,562,609 S282P probably benign Het
Chrnb4 T G 9: 55,035,012 H326P probably damaging Het
Cntnap1 A G 11: 101,183,477 T748A probably benign Het
Cpsf3 T A 12: 21,297,928 L250H probably damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dppa5a T A 9: 78,368,071 D10V possibly damaging Het
Dsc2 G A 18: 20,046,279 T244I probably damaging Het
Elavl4 T C 4: 110,213,206 T144A probably benign Het
Ephb1 C T 9: 101,936,116 V776M probably damaging Het
Fcrl1 C T 3: 87,391,242 S348F probably benign Het
Galnt14 A G 17: 73,495,666 V477A probably damaging Het
Gcdh A G 8: 84,892,857 L103P probably damaging Het
Gm27013 G A 6: 130,675,979 T840I probably damaging Het
Gpr179 A T 11: 97,338,330 W1000R probably damaging Het
Hectd4 C T 5: 121,281,101 A581V unknown Het
Ints12 T A 3: 133,109,160 V376E probably damaging Het
Krt77 T C 15: 101,861,230 I402V probably benign Het
March1 T C 8: 66,418,890 V102A probably damaging Het
Meis1 A T 11: 19,016,168 N68K probably benign Het
Mthfd1l A G 10: 4,106,432 E916G probably benign Het
Muc5ac T C 7: 141,807,832 F1627L possibly damaging Het
Myef2 A T 2: 125,116,703 M102K probably benign Het
Naip6 A C 13: 100,298,915 H1033Q probably benign Het
Nid1 T A 13: 13,489,037 C760* probably null Het
Nt5dc1 A T 10: 34,397,230 C191S probably benign Het
Nup214 A G 2: 31,988,176 E285G possibly damaging Het
Nvl A G 1: 181,135,036 L123P probably damaging Het
Olfr1094 T A 2: 86,829,317 H188Q probably damaging Het
Otog A G 7: 46,261,699 E658G probably damaging Het
Pam16 G T 16: 4,618,016 probably benign Het
Psg17 T C 7: 18,819,926 D133G probably benign Het
Rabgap1l A G 1: 160,351,328 S21P possibly damaging Het
Rgs22 T A 15: 36,099,652 M306L probably damaging Het
Ruvbl1 A G 6: 88,467,600 K59R probably benign Het
Samd9l T C 6: 3,373,898 E1121G possibly damaging Het
Serpinb13 A G 1: 106,998,602 N169S probably benign Het
Setbp1 T A 18: 79,086,712 T102S probably damaging Het
Syn3 A T 10: 86,080,226 S299T probably benign Het
Taar7a A G 10: 23,992,631 L284P probably damaging Het
Tlr6 C A 5: 64,953,406 Q719H probably damaging Het
Tmem131 T A 1: 36,889,280 D76V probably damaging Het
Tradd T G 8: 105,259,625 D145A possibly damaging Het
Usp20 A T 2: 31,010,226 M251L probably benign Het
Vmn2r96 T A 17: 18,597,829 L556Q probably damaging Het
Xrcc2 A G 5: 25,692,319 S211P probably benign Het
Other mutations in Fga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Fga APN 3 83031674 missense probably damaging 1.00
IGL00478:Fga APN 3 83028644 missense probably benign 0.00
IGL00587:Fga APN 3 83030289 missense possibly damaging 0.62
IGL01289:Fga APN 3 83031245 missense possibly damaging 0.85
IGL01323:Fga APN 3 83030211 missense probably damaging 0.99
IGL01369:Fga APN 3 83030200 missense probably benign 0.00
IGL01409:Fga APN 3 83032752 missense probably damaging 1.00
IGL01541:Fga APN 3 83032707 missense probably damaging 1.00
IGL01633:Fga APN 3 83030299 missense possibly damaging 0.89
IGL01966:Fga APN 3 83029154 missense probably damaging 0.97
IGL02651:Fga APN 3 83028534 missense probably benign 0.00
IGL02822:Fga APN 3 83031482 missense probably damaging 1.00
IGL03003:Fga APN 3 83032730 missense probably damaging 1.00
R0336:Fga UTSW 3 83030857 missense probably damaging 1.00
R0540:Fga UTSW 3 83028562 missense probably damaging 1.00
R0607:Fga UTSW 3 83028562 missense probably damaging 1.00
R1471:Fga UTSW 3 83028618 missense probably benign 0.16
R1517:Fga UTSW 3 83031838 missense probably benign 0.00
R1817:Fga UTSW 3 83031775 missense probably benign 0.00
R1874:Fga UTSW 3 83032721 missense probably damaging 1.00
R2014:Fga UTSW 3 83032757 missense probably damaging 0.99
R2267:Fga UTSW 3 83032950 missense probably damaging 1.00
R2332:Fga UTSW 3 83031397 missense probably damaging 1.00
R2420:Fga UTSW 3 83033154 missense possibly damaging 0.53
R2443:Fga UTSW 3 83028541 missense probably benign 0.03
R3978:Fga UTSW 3 83030183 critical splice acceptor site probably null
R4597:Fga UTSW 3 83031235 nonsense probably null
R4644:Fga UTSW 3 83030266 missense possibly damaging 0.81
R4760:Fga UTSW 3 83031514 missense probably benign
R4867:Fga UTSW 3 83028644 missense probably benign 0.00
R5449:Fga UTSW 3 83030862 frame shift probably null
R5712:Fga UTSW 3 83033133 missense possibly damaging 0.70
R6853:Fga UTSW 3 83030912 missense probably damaging 1.00
R6865:Fga UTSW 3 83031541 missense probably damaging 1.00
R7163:Fga UTSW 3 83026264 missense probably benign 0.04
R7724:Fga UTSW 3 83029125 missense probably damaging 0.99
R8153:Fga UTSW 3 83030857 missense probably damaging 1.00
R8506:Fga UTSW 3 83033316 missense probably damaging 1.00
R8511:Fga UTSW 3 83031757 nonsense probably null
X0062:Fga UTSW 3 83030271 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CTTATGCGGAGTACCACTTCC -3'
(R):5'- AGTTCACAAGATCCGTGACAC -3'

Sequencing Primer
(F):5'- CATGCAGTTCAGTACCTTTGACAGAG -3'
(R):5'- AGATCCGTGACACCTTCATC -3'
Posted On2016-10-05