Mutagenetix > Incidental Mutation

Incidental Mutation 'R5507:Dsc2'

431011

Institutional Source

Beutler Lab

Gene Symbol

Dsc2

Ensembl Gene

ENSMUSG00000024331

Gene Name

desmocollin 2

Synonyms

Dsc2b, Dsc2a

MMRRC Submission

043068-MU

Accession Numbers

Genbank: NM_013505; MGI: 103221

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5507 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20030633-20059554 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 20046279 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 244 (T244I)

Ref Sequence

ENSEMBL: ENSMUSP00000074702 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]

AlphaFold

P55292

Predicted Effect

probably damaging
Transcript: ENSMUST00000039247
AA Change: T244I

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331
AA Change: T244I

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000075214
AA Change: T244I

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: T244I

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC
Pfam:Cadherin_C	730	901	3.7e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128464

SMART Domains

Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART

Meta Mutation Damage Score

0.1416

Coding Region Coverage

1x: 98.3%
3x: 97.3%
10x: 95.3%
20x: 91.2%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700009N14Rik	A	G	4: 39,451,084	T97A	probably damaging	Het
1700017N19Rik	T	C	10: 100,609,233	S27P	probably benign	Het
Acoxl	C	A	2: 127,884,474	A256E	probably damaging	Het
Akap9	A	G	5: 3,968,683	E1088G	probably benign	Het
Alox12	T	C	11: 70,254,412	T112A	possibly damaging	Het
Ampd2	A	G	3: 108,077,613	V379A	probably damaging	Het
Ap4e1	C	A	2: 127,008,898	H49N	probably damaging	Het
Arhgap11a	T	C	2: 113,841,678	T260A	probably benign	Het
Atg2a	T	C	19: 6,245,070	F171S	possibly damaging	Het
Bpifb9b	A	T	2: 154,317,027	Y488F	possibly damaging	Het
C2cd2	T	C	16: 97,881,620	T139A	probably benign	Het
Cct8l1	A	T	5: 25,516,379	T31S	probably benign	Het
Cdhr1	A	T	14: 37,082,845	N469K	probably damaging	Het
Chga	T	C	12: 102,562,609	S282P	probably benign	Het
Chrnb4	T	G	9: 55,035,012	H326P	probably damaging	Het
Cntnap1	A	G	11: 101,183,477	T748A	probably benign	Het
Cpsf3	T	A	12: 21,297,928	L250H	probably damaging	Het
Dnajb12	GC	G	10: 59,892,752		probably null	Het
Dppa5a	T	A	9: 78,368,071	D10V	possibly damaging	Het
Elavl4	T	C	4: 110,213,206	T144A	probably benign	Het
Ephb1	C	T	9: 101,936,116	V776M	probably damaging	Het
Fcrl1	C	T	3: 87,391,242	S348F	probably benign	Het
Fga	T	A	3: 83,033,336	W766R	probably damaging	Het
Galnt14	A	G	17: 73,495,666	V477A	probably damaging	Het
Gcdh	A	G	8: 84,892,857	L103P	probably damaging	Het
Gm27013	G	A	6: 130,675,979	T840I	probably damaging	Het
Gpr179	A	T	11: 97,338,330	W1000R	probably damaging	Het
Hectd4	C	T	5: 121,281,101	A581V	unknown	Het
Ints12	T	A	3: 133,109,160	V376E	probably damaging	Het
Krt77	T	C	15: 101,861,230	I402V	probably benign	Het
March1	T	C	8: 66,418,890	V102A	probably damaging	Het
Meis1	A	T	11: 19,016,168	N68K	probably benign	Het
Mthfd1l	A	G	10: 4,106,432	E916G	probably benign	Het
Muc5ac	T	C	7: 141,807,832	F1627L	possibly damaging	Het
Myef2	A	T	2: 125,116,703	M102K	probably benign	Het
Naip6	A	C	13: 100,298,915	H1033Q	probably benign	Het
Nid1	T	A	13: 13,489,037	C760*	probably null	Het
Nt5dc1	A	T	10: 34,397,230	C191S	probably benign	Het
Nup214	A	G	2: 31,988,176	E285G	possibly damaging	Het
Nvl	A	G	1: 181,135,036	L123P	probably damaging	Het
Olfr1094	T	A	2: 86,829,317	H188Q	probably damaging	Het
Otog	A	G	7: 46,261,699	E658G	probably damaging	Het
Pam16	G	T	16: 4,618,016		probably benign	Het
Psg17	T	C	7: 18,819,926	D133G	probably benign	Het
Rabgap1l	A	G	1: 160,351,328	S21P	possibly damaging	Het
Rgs22	T	A	15: 36,099,652	M306L	probably damaging	Het
Ruvbl1	A	G	6: 88,467,600	K59R	probably benign	Het
Samd9l	T	C	6: 3,373,898	E1121G	possibly damaging	Het
Serpinb13	A	G	1: 106,998,602	N169S	probably benign	Het
Setbp1	T	A	18: 79,086,712	T102S	probably damaging	Het
Syn3	A	T	10: 86,080,226	S299T	probably benign	Het
Taar7a	A	G	10: 23,992,631	L284P	probably damaging	Het
Tlr6	C	A	5: 64,953,406	Q719H	probably damaging	Het
Tmem131	T	A	1: 36,889,280	D76V	probably damaging	Het
Tradd	T	G	8: 105,259,625	D145A	possibly damaging	Het
Usp20	A	T	2: 31,010,226	M251L	probably benign	Het
Vmn2r96	T	A	17: 18,597,829	L556Q	probably damaging	Het
Xrcc2	A	G	5: 25,692,319	S211P	probably benign	Het

Other mutations in Dsc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00802:Dsc2	APN	18	20041797	missense	probably benign	0.01
IGL00826:Dsc2	APN	18	20035315	missense	probably damaging	1.00
IGL00852:Dsc2	APN	18	20034683	missense	probably benign	0.01
IGL01082:Dsc2	APN	18	20043792	missense	probably damaging	1.00
IGL01328:Dsc2	APN	18	20048286	missense	probably damaging	0.98
IGL01338:Dsc2	APN	18	20047157	missense	probably benign	0.19
IGL01727:Dsc2	APN	18	20038200	missense	probably benign	0.01
IGL01766:Dsc2	APN	18	20046342	missense	possibly damaging	0.56
IGL02228:Dsc2	APN	18	20043733	missense	probably damaging	0.99
IGL02560:Dsc2	APN	18	20045539	missense	probably damaging	1.00
IGL02794:Dsc2	APN	18	20041731	missense	probably damaging	1.00
3-1:Dsc2	UTSW	18	20047079	missense	possibly damaging	0.60
PIT4305001:Dsc2	UTSW	18	20046243	missense	probably damaging	0.96
PIT4431001:Dsc2	UTSW	18	20046277	nonsense	probably null
R0288:Dsc2	UTSW	18	20033120	missense	probably damaging	1.00
R0542:Dsc2	UTSW	18	20051226	missense	probably damaging	0.99
R0562:Dsc2	UTSW	18	20041537	missense	probably damaging	0.99
R0697:Dsc2	UTSW	18	20041452	missense	probably damaging	0.99
R0940:Dsc2	UTSW	18	20050059	missense	probably damaging	0.97
R1081:Dsc2	UTSW	18	20033295	missense	probably damaging	0.96
R1140:Dsc2	UTSW	18	20032212	missense	probably damaging	1.00
R1515:Dsc2	UTSW	18	20034701	missense	probably damaging	0.99
R1515:Dsc2	UTSW	18	20045565	missense	probably benign	0.40
R1558:Dsc2	UTSW	18	20050151	missense	probably damaging	0.99
R1654:Dsc2	UTSW	18	20046246	missense	probably benign	0.01
R2061:Dsc2	UTSW	18	20032399	missense	possibly damaging	0.79
R2089:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2172:Dsc2	UTSW	18	20045502	missense	probably damaging	1.00
R2247:Dsc2	UTSW	18	20035312	missense	probably damaging	1.00
R2472:Dsc2	UTSW	18	20045469	missense	probably benign	0.00
R2927:Dsc2	UTSW	18	20045501	missense	probably damaging	1.00
R3611:Dsc2	UTSW	18	20032351	missense	probably damaging	0.99
R3961:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R3963:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R4353:Dsc2	UTSW	18	20050068	missense	probably damaging	1.00
R4362:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R4612:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4613:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4752:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R4946:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R5056:Dsc2	UTSW	18	20050142	missense	probably damaging	1.00
R5267:Dsc2	UTSW	18	20034583	critical splice donor site	probably null
R5445:Dsc2	UTSW	18	20035303	missense	possibly damaging	0.76
R5575:Dsc2	UTSW	18	20035390	missense	probably damaging	1.00
R5781:Dsc2	UTSW	18	20032510	missense	probably benign	0.00
R6102:Dsc2	UTSW	18	20047108	missense	probably benign	0.01
R6129:Dsc2	UTSW	18	20045430	missense	possibly damaging	0.95
R6362:Dsc2	UTSW	18	20035463	nonsense	probably null
R6433:Dsc2	UTSW	18	20051175	critical splice donor site	probably null
R6513:Dsc2	UTSW	18	20046238	missense	probably benign
R6615:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.88
R6619:Dsc2	UTSW	18	20032278	missense	probably benign	0.22
R6665:Dsc2	UTSW	18	20050148	missense	probably damaging	1.00
R6961:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R7179:Dsc2	UTSW	18	20035275	critical splice donor site	probably null
R7275:Dsc2	UTSW	18	20051179	nonsense	probably null
R7352:Dsc2	UTSW	18	20035335	missense	probably benign	0.39
R7386:Dsc2	UTSW	18	20041926	missense	possibly damaging	0.84
R7496:Dsc2	UTSW	18	20035394	nonsense	probably null
R7510:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R7580:Dsc2	UTSW	18	20050073	missense	probably damaging	1.00
R7718:Dsc2	UTSW	18	20041778	missense	probably damaging	0.98
R7733:Dsc2	UTSW	18	20048315	missense	probably benign	0.00
R7733:Dsc2	UTSW	18	20048316	missense	probably benign	0.16
R7818:Dsc2	UTSW	18	20050132	missense	probably damaging	1.00
R7852:Dsc2	UTSW	18	20046285	missense	possibly damaging	0.67
R7998:Dsc2	UTSW	18	20034663	missense	possibly damaging	0.87
R8029:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8030:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8031:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8032:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8059:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8060:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8061:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8062:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8063:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8082:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8090:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8114:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8115:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8116:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8117:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8118:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8328:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.68
R8545:Dsc2	UTSW	18	20034665	nonsense	probably null
R9005:Dsc2	UTSW	18	20038094	missense	probably benign	0.00
R9017:Dsc2	UTSW	18	20043911	missense	probably damaging	1.00
R9111:Dsc2	UTSW	18	20034707	missense	probably benign	0.00
R9396:Dsc2	UTSW	18	20041716	nonsense	probably null
R9487:Dsc2	UTSW	18	20047219	missense	probably damaging	0.99
R9663:Dsc2	UTSW	18	20038148	missense	probably damaging	1.00
Z1088:Dsc2	UTSW	18	20046304	missense	probably damaging	0.98
Z1176:Dsc2	UTSW	18	20035299	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAGATAACCCATTGGCTGG -3'
(R):5'- TGAATTCCATTCCCAGCACC -3'

Sequencing Primer
(F):5'- TTGTCAAACCAAGAAACCGGTG -3'
(R):5'- TTCCATTCCCAGCACCACAAAAG -3'

Posted On

2016-10-05