Incidental Mutation 'R5508:Klf14'
ID431030
Institutional Source Beutler Lab
Gene Symbol Klf14
Ensembl Gene ENSMUSG00000073209
Gene NameKruppel-like factor 14
SynonymsBTEB5, 5330411L03Rik
MMRRC Submission 043069-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5508 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location30956023-30959078 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30958042 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 219 (H219R)
Ref Sequence ENSEMBL: ENSMUSP00000099122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101589]
Predicted Effect probably damaging
Transcript: ENSMUST00000101589
AA Change: H219R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099122
Gene: ENSMUSG00000073209
AA Change: H219R

DomainStartEndE-ValueType
low complexity region 33 51 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
ZnF_C2H2 195 219 1.64e-1 SMART
ZnF_C2H2 225 249 1.98e-4 SMART
ZnF_C2H2 255 277 1.12e-3 SMART
low complexity region 288 301 N/A INTRINSIC
low complexity region 306 316 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.7%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a member of the Kruppel-like family of transcription factors. The encoded protein functions as a transcriptional co-repressor, and is induced by transforming growth factor-beta (TGF-beta) to repress TGF-beta receptor II gene expression. This gene exhibits imprinted expression from the maternal allele in embryonic and extra-embryonic tissues. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null allele display genome instability and increased tumor incidence with age. Mice homozygous for a conditional allele knocked out in the liver exhibit decreased circulating HDL cholesterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,538,084 probably null Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Apc A G 18: 34,298,580 D344G probably damaging Het
Asphd2 A T 5: 112,386,783 F300I probably damaging Het
BC016579 T A 16: 45,633,006 T149S possibly damaging Het
Bcl6b A T 11: 70,226,093 H453Q probably damaging Het
Clec4b2 A G 6: 123,173,042 probably benign Het
Crispld1 G T 1: 17,752,983 C396F probably damaging Het
Dnase1l3 A G 14: 7,968,146 V253A probably damaging Het
Efhd1 A G 1: 87,309,794 *241W probably null Het
Flvcr1 C T 1: 191,025,459 G212D probably damaging Het
Golga2 T A 2: 32,288,187 L36* probably null Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gtf3c2 G T 5: 31,174,461 C4* probably null Het
Kit G T 5: 75,649,548 C786F probably damaging Het
Large2 A G 2: 92,369,903 V122A possibly damaging Het
Lct G A 1: 128,294,131 A1557V probably damaging Het
Lrp6 T G 6: 134,464,516 K1162N probably benign Het
Mtmr11 G A 3: 96,163,767 R147Q probably damaging Het
Pbld2 T A 10: 63,066,665 probably null Het
Pcdhb3 A T 18: 37,301,126 L48F probably damaging Het
Pdcd2 C T 17: 15,521,739 D310N probably damaging Het
Phlpp1 G T 1: 106,364,390 R993L probably benign Het
Prr36 G A 8: 4,216,488 P21S probably damaging Het
Ptprq C A 10: 107,686,231 V620L probably benign Het
Ranbp2 T A 10: 58,480,005 D2182E probably damaging Het
Sass6 G A 3: 116,620,103 R485K probably benign Het
Scoc A T 8: 83,435,942 S68T probably damaging Het
Speer3 T A 5: 13,794,664 L114I probably damaging Het
Ss18l1 C G 2: 180,057,653 Q215E probably damaging Het
Stab2 T C 10: 86,960,279 N368S probably benign Het
Trim80 T A 11: 115,445,078 S275R probably benign Het
Tubb5 T C 17: 35,835,070 N416S probably benign Het
Ugt2a3 A T 5: 87,327,200 M395K probably damaging Het
Vmn2r61 T A 7: 42,266,818 M285K possibly damaging Het
Xpo1 A G 11: 23,294,645 I1008V probably benign Het
Other mutations in Klf14
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4518:Klf14 UTSW 6 30957932 missense possibly damaging 0.77
R4562:Klf14 UTSW 6 30958459 missense probably damaging 1.00
R4771:Klf14 UTSW 6 30958025 missense probably damaging 1.00
R5910:Klf14 UTSW 6 30957839 missense probably benign 0.08
R7105:Klf14 UTSW 6 30958541 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATGGTAAGTTGGATGGCGAC -3'
(R):5'- TGATTCTGCTATCCTGGATGC -3'

Sequencing Primer
(F):5'- CGACGAGCATGCTTGGTC -3'
(R):5'- TATCCTGGATGCGCCTGAG -3'
Posted On2016-10-05