Incidental Mutation 'R5508:Prr36'
ID431034
Institutional Source Beutler Lab
Gene Symbol Prr36
Ensembl Gene ENSMUSG00000064125
Gene Nameproline rich 36
SynonymsBC068157
MMRRC Submission 043069-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R5508 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location4209543-4217459 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4216488 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 21 (P21S)
Ref Sequence ENSEMBL: ENSMUSP00000135130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168386] [ENSMUST00000175906] [ENSMUST00000176227] [ENSMUST00000177491]
Predicted Effect unknown
Transcript: ENSMUST00000168386
AA Change: P21S
SMART Domains Protein: ENSMUSP00000133114
Gene: ENSMUSG00000064125
AA Change: P21S

DomainStartEndE-ValueType
low complexity region 26 38 N/A INTRINSIC
internal_repeat_1 63 82 5.9e-10 PROSPERO
internal_repeat_1 87 106 5.9e-10 PROSPERO
low complexity region 109 123 N/A INTRINSIC
low complexity region 358 388 N/A INTRINSIC
low complexity region 390 425 N/A INTRINSIC
low complexity region 466 497 N/A INTRINSIC
low complexity region 543 567 N/A INTRINSIC
low complexity region 571 612 N/A INTRINSIC
low complexity region 647 726 N/A INTRINSIC
low complexity region 733 751 N/A INTRINSIC
low complexity region 755 780 N/A INTRINSIC
low complexity region 783 867 N/A INTRINSIC
low complexity region 1020 1045 N/A INTRINSIC
Pfam:DUF4596 1053 1098 4.1e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000175906
AA Change: P21S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135713
Gene: ENSMUSG00000064125
AA Change: P21S

DomainStartEndE-ValueType
low complexity region 26 38 N/A INTRINSIC
internal_repeat_1 63 82 5.38e-8 PROSPERO
internal_repeat_1 87 106 5.38e-8 PROSPERO
low complexity region 109 123 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176227
AA Change: P21S

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000177491
AA Change: P21S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135130
Gene: ENSMUSG00000064125
AA Change: P21S

DomainStartEndE-ValueType
low complexity region 26 38 N/A INTRINSIC
internal_repeat_1 63 82 1.65e-6 PROSPERO
internal_repeat_1 87 106 1.65e-6 PROSPERO
low complexity region 109 123 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.7%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein of unknown function that contains internal regions of low complexity sequence. Alternative splicing results in multiple transcript variants. The transcript structure of the protein-coding variant at this locus is conserved between human and mouse. [provided by RefSeq, Oct 2013]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,538,084 probably null Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Apc A G 18: 34,298,580 D344G probably damaging Het
Asphd2 A T 5: 112,386,783 F300I probably damaging Het
BC016579 T A 16: 45,633,006 T149S possibly damaging Het
Bcl6b A T 11: 70,226,093 H453Q probably damaging Het
Clec4b2 A G 6: 123,173,042 probably benign Het
Crispld1 G T 1: 17,752,983 C396F probably damaging Het
Dnase1l3 A G 14: 7,968,146 V253A probably damaging Het
Efhd1 A G 1: 87,309,794 *241W probably null Het
Flvcr1 C T 1: 191,025,459 G212D probably damaging Het
Golga2 T A 2: 32,288,187 L36* probably null Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gtf3c2 G T 5: 31,174,461 C4* probably null Het
Kit G T 5: 75,649,548 C786F probably damaging Het
Klf14 T C 6: 30,958,042 H219R probably damaging Het
Large2 A G 2: 92,369,903 V122A possibly damaging Het
Lct G A 1: 128,294,131 A1557V probably damaging Het
Lrp6 T G 6: 134,464,516 K1162N probably benign Het
Mtmr11 G A 3: 96,163,767 R147Q probably damaging Het
Pbld2 T A 10: 63,066,665 probably null Het
Pcdhb3 A T 18: 37,301,126 L48F probably damaging Het
Pdcd2 C T 17: 15,521,739 D310N probably damaging Het
Phlpp1 G T 1: 106,364,390 R993L probably benign Het
Ptprq C A 10: 107,686,231 V620L probably benign Het
Ranbp2 T A 10: 58,480,005 D2182E probably damaging Het
Sass6 G A 3: 116,620,103 R485K probably benign Het
Scoc A T 8: 83,435,942 S68T probably damaging Het
Speer3 T A 5: 13,794,664 L114I probably damaging Het
Ss18l1 C G 2: 180,057,653 Q215E probably damaging Het
Stab2 T C 10: 86,960,279 N368S probably benign Het
Trim80 T A 11: 115,445,078 S275R probably benign Het
Tubb5 T C 17: 35,835,070 N416S probably benign Het
Ugt2a3 A T 5: 87,327,200 M395K probably damaging Het
Vmn2r61 T A 7: 42,266,818 M285K possibly damaging Het
Xpo1 A G 11: 23,294,645 I1008V probably benign Het
Other mutations in Prr36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Prr36 APN 8 4216230 missense probably benign 0.01
IGL01535:Prr36 APN 8 4214043 unclassified probably benign
IGL01658:Prr36 APN 8 4215243 missense probably damaging 1.00
IGL01710:Prr36 APN 8 4215243 missense probably damaging 1.00
IGL01712:Prr36 APN 8 4215243 missense probably damaging 1.00
IGL01713:Prr36 APN 8 4215243 missense probably damaging 1.00
IGL01892:Prr36 APN 8 4215243 missense probably damaging 1.00
IGL01893:Prr36 APN 8 4215243 missense probably damaging 1.00
IGL02496:Prr36 APN 8 4216407 nonsense probably null
IGL02829:Prr36 APN 8 4215278 missense possibly damaging 0.55
R0479:Prr36 UTSW 8 4213930 nonsense probably null
R0667:Prr36 UTSW 8 4216311 unclassified probably benign
R0784:Prr36 UTSW 8 4213771 unclassified probably benign
R1737:Prr36 UTSW 8 4214370 unclassified probably benign
R2017:Prr36 UTSW 8 4215205 missense probably benign 0.02
R2032:Prr36 UTSW 8 4214304 unclassified probably benign
R2430:Prr36 UTSW 8 4213488 unclassified probably benign
R4160:Prr36 UTSW 8 4212910 missense probably benign 0.10
R4184:Prr36 UTSW 8 4213409 unclassified probably benign
R4393:Prr36 UTSW 8 4214901 unclassified probably benign
R4887:Prr36 UTSW 8 4210881 missense probably benign 0.01
R5628:Prr36 UTSW 8 4216273 small deletion probably benign
R6189:Prr36 UTSW 8 4214177 unclassified probably benign
R6277:Prr36 UTSW 8 4214746 unclassified probably benign
R7185:Prr36 UTSW 8 4216458 missense probably damaging 1.00
R7286:Prr36 UTSW 8 4215163 critical splice donor site probably benign
R7338:Prr36 UTSW 8 4216212 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTGGAAGAGCTGCTTTGC -3'
(R):5'- TAGGCTGAGGTTTAGGCACC -3'

Sequencing Primer
(F):5'- TGGAAGAGCGGCTTTGC -3'
(R):5'- CTGAGGTTTAGGCACCCATGG -3'
Posted On2016-10-05