Incidental Mutation 'R5508:Pbld2'
ID431037
Institutional Source Beutler Lab
Gene Symbol Pbld2
Ensembl Gene ENSMUSG00000020072
Gene Namephenazine biosynthesis-like protein domain containing 2
Synonyms3110049J23Rik
MMRRC Submission 043069-MU
Accession Numbers

Genbank: NM_026085 ; MGI: 1914557

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5508 (G1)
Quality Score179
Status Not validated
Chromosome10
Chromosomal Location63024315-63058813 bp(+) (GRCm38)
Type of Mutationunclassified (2537 bp from exon)
DNA Base Change (assembly) T to A at 63066665 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020266] [ENSMUST00000178684] [ENSMUST00000219045] [ENSMUST00000219687]
Predicted Effect probably null
Transcript: ENSMUST00000020266
SMART Domains Protein: ENSMUSP00000020266
Gene: ENSMUSG00000112129

DomainStartEndE-ValueType
Pfam:PhzC-PhzF 8 285 7e-68 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000178684
SMART Domains Protein: ENSMUSP00000136589
Gene: ENSMUSG00000112129

DomainStartEndE-ValueType
Pfam:PhzC-PhzF 8 284 2.6e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218401
Predicted Effect probably null
Transcript: ENSMUST00000219045
Predicted Effect probably null
Transcript: ENSMUST00000219687
Predicted Effect probably benign
Transcript: ENSMUST00000219829
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.7%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI

All alleles(21) : Gene trapped(21)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,538,084 probably null Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Apc A G 18: 34,298,580 D344G probably damaging Het
Asphd2 A T 5: 112,386,783 F300I probably damaging Het
BC016579 T A 16: 45,633,006 T149S possibly damaging Het
Bcl6b A T 11: 70,226,093 H453Q probably damaging Het
Clec4b2 A G 6: 123,173,042 probably benign Het
Crispld1 G T 1: 17,752,983 C396F probably damaging Het
Dnase1l3 A G 14: 7,968,146 V253A probably damaging Het
Efhd1 A G 1: 87,309,794 *241W probably null Het
Flvcr1 C T 1: 191,025,459 G212D probably damaging Het
Golga2 T A 2: 32,288,187 L36* probably null Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gtf3c2 G T 5: 31,174,461 C4* probably null Het
Kit G T 5: 75,649,548 C786F probably damaging Het
Klf14 T C 6: 30,958,042 H219R probably damaging Het
Large2 A G 2: 92,369,903 V122A possibly damaging Het
Lct G A 1: 128,294,131 A1557V probably damaging Het
Lrp6 T G 6: 134,464,516 K1162N probably benign Het
Mtmr11 G A 3: 96,163,767 R147Q probably damaging Het
Pcdhb3 A T 18: 37,301,126 L48F probably damaging Het
Pdcd2 C T 17: 15,521,739 D310N probably damaging Het
Phlpp1 G T 1: 106,364,390 R993L probably benign Het
Prr36 G A 8: 4,216,488 P21S probably damaging Het
Ptprq C A 10: 107,686,231 V620L probably benign Het
Ranbp2 T A 10: 58,480,005 D2182E probably damaging Het
Sass6 G A 3: 116,620,103 R485K probably benign Het
Scoc A T 8: 83,435,942 S68T probably damaging Het
Speer3 T A 5: 13,794,664 L114I probably damaging Het
Ss18l1 C G 2: 180,057,653 Q215E probably damaging Het
Stab2 T C 10: 86,960,279 N368S probably benign Het
Trim80 T A 11: 115,445,078 S275R probably benign Het
Tubb5 T C 17: 35,835,070 N416S probably benign Het
Ugt2a3 A T 5: 87,327,200 M395K probably damaging Het
Vmn2r61 T A 7: 42,266,818 M285K possibly damaging Het
Xpo1 A G 11: 23,294,645 I1008V probably benign Het
Other mutations in Pbld2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Pbld2 APN 10 63071955 missense probably benign 0.01
IGL02162:Pbld2 APN 10 63071400 splice site probably benign
IGL03206:Pbld2 APN 10 63047482 missense probably benign 0.06
R0311:Pbld2 UTSW 10 63054507 critical splice donor site probably null
R0366:Pbld2 UTSW 10 63053957 unclassified probably benign
R0727:Pbld2 UTSW 10 63067519 missense probably benign 0.03
R0731:Pbld2 UTSW 10 63056811 missense probably damaging 1.00
R1412:Pbld2 UTSW 10 63047522 missense probably damaging 1.00
R1523:Pbld2 UTSW 10 63076433 missense probably benign 0.01
R1531:Pbld2 UTSW 10 63053953 critical splice donor site probably null
R1773:Pbld2 UTSW 10 63054371 missense probably benign 0.03
R1778:Pbld2 UTSW 10 63054371 missense probably benign 0.03
R1797:Pbld2 UTSW 10 63075124 critical splice donor site probably null
R2251:Pbld2 UTSW 10 63024605 unclassified probably benign
R3036:Pbld2 UTSW 10 63071446 missense probably damaging 1.00
R3117:Pbld2 UTSW 10 63054436 missense probably benign 0.00
R3622:Pbld2 UTSW 10 63061691 missense probably damaging 0.97
R3624:Pbld2 UTSW 10 63061691 missense probably damaging 0.97
R3734:Pbld2 UTSW 10 63071465 missense probably damaging 1.00
R4260:Pbld2 UTSW 10 63024407 unclassified probably benign
R4684:Pbld2 UTSW 10 63057697 missense probably damaging 1.00
R4928:Pbld2 UTSW 10 63047999 missense probably damaging 1.00
R4936:Pbld2 UTSW 10 63052238 missense probably damaging 1.00
R5596:Pbld2 UTSW 10 63072012 missense probably damaging 1.00
R5603:Pbld2 UTSW 10 63071449 missense probably benign
R6298:Pbld2 UTSW 10 63039152 missense probably benign 0.05
R6404:Pbld2 UTSW 10 63054328 missense probably damaging 0.98
R7089:Pbld2 UTSW 10 63053912 missense probably benign 0.23
R7134:Pbld2 UTSW 10 63024589 unclassified probably benign
R7423:Pbld2 UTSW 10 63048004 missense probably damaging 1.00
R8016:Pbld2 UTSW 10 63047965 missense probably damaging 1.00
R8039:Pbld2 UTSW 10 63047992 missense probably damaging 1.00
R8119:Pbld2 UTSW 10 63053877 missense probably benign 0.34
YA93:Pbld2 UTSW 10 63054445 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CTGACTTGCATCCCTTTGGC -3'
(R):5'- CTGAGCTACTGACCCAGCCA -3'

Sequencing Primer
(F):5'- GGCTTTTCCTCCTCTGAAGG -3'
(R):5'- ACTAGCCTGGAACTCCCTATGTAGG -3'
Posted On2016-10-05