Mutagenetix > Incidental Mutations

Incidental Mutation 'R5508:Gprc5c'

431043

Institutional Source

Beutler Lab

Gene Symbol

Gprc5c

Ensembl Gene

ENSMUSG00000051043

Gene Name

G protein-coupled receptor, family C, group 5, member C

Synonyms

MMRRC Submission

043069-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.199) question?

Stock #

R5508 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

114851152-114872617 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 114864267 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 257 (V257L)

Ref Sequence

ENSEMBL: ENSMUSP00000061760 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021071] [ENSMUST00000053361] [ENSMUST00000122967] [ENSMUST00000133245] [ENSMUST00000136785] [ENSMUST00000142262] [ENSMUST00000152314] [ENSMUST00000177952]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000021071
AA Change: V257L

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000021071
Gene: ENSMUSG00000051043
AA Change: V257L

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:7tm_3	58	302	1.3e-42	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000053361
AA Change: V257L

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000061760
Gene: ENSMUSG00000051043
AA Change: V257L

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:7tm_3	60	301	1.3e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000122967

SMART Domains

Protein: ENSMUSP00000114335
Gene: ENSMUSG00000051043

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
transmembrane domain	55	77	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000133245

SMART Domains

Protein: ENSMUSP00000121572
Gene: ENSMUSG00000051043

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
transmembrane domain	55	77	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000136785
AA Change: V257L

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000116786
Gene: ENSMUSG00000051043
AA Change: V257L

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:7tm_3	58	283	1.5e-38	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000142262

SMART Domains

Protein: ENSMUSP00000121524
Gene: ENSMUSG00000051043

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:7tm_3	58	133	6.2e-14	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000152314

Predicted Effect

possibly damaging
Transcript: ENSMUST00000177952
AA Change: V257L

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000136702
Gene: ENSMUSG00000051043
AA Change: V257L

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:7tm_3	58	302	1.3e-42	PFAM

Meta Mutation Damage Score

0.1280

Coding Region Coverage

1x: 98.4%
3x: 97.4%
10x: 95.7%
20x: 92.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the type 3 G protein-coupled receptor family. Members of this superfamily are characterized by a signature 7-transmembrane domain motif. The specific function of this protein is unknown; however, this protein may mediate the cellular effects of retinoic acid on the G protein signal transduction cascade. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele are behaviorally normal but exhibit reticulocytosis, increased mean corpuscular volume, increased percentage of basophils, decreased mean corpuscular hemogloblin concentration, and increased alkaline phophatase and lactic dehydrogenase levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011I03Rik	G	A	18: 57,538,084		probably null	Het
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Apc	A	G	18: 34,298,580	D344G	probably damaging	Het
Asphd2	A	T	5: 112,386,783	F300I	probably damaging	Het
BC016579	T	A	16: 45,633,006	T149S	possibly damaging	Het
Bcl6b	A	T	11: 70,226,093	H453Q	probably damaging	Het
Clec4b2	A	G	6: 123,173,042		probably benign	Het
Crispld1	G	T	1: 17,752,983	C396F	probably damaging	Het
Dnase1l3	A	G	14: 7,968,146	V253A	probably damaging	Het
Efhd1	A	G	1: 87,309,794	*241W	probably null	Het
Flvcr1	C	T	1: 191,025,459	G212D	probably damaging	Het
Golga2	T	A	2: 32,288,187	L36*	probably null	Het
Gtf3c2	G	T	5: 31,174,461	C4*	probably null	Het
Kit	G	T	5: 75,649,548	C786F	probably damaging	Het
Klf14	T	C	6: 30,958,042	H219R	probably damaging	Het
Large2	A	G	2: 92,369,903	V122A	possibly damaging	Het
Lct	G	A	1: 128,294,131	A1557V	probably damaging	Het
Lrp6	T	G	6: 134,464,516	K1162N	probably benign	Het
Mtmr11	G	A	3: 96,163,767	R147Q	probably damaging	Het
Pbld2	T	A	10: 63,066,665		probably null	Het
Pcdhb3	A	T	18: 37,301,126	L48F	probably damaging	Het
Pdcd2	C	T	17: 15,521,739	D310N	probably damaging	Het
Phlpp1	G	T	1: 106,364,390	R993L	probably benign	Het
Prr36	G	A	8: 4,216,488	P21S	probably damaging	Het
Ptprq	C	A	10: 107,686,231	V620L	probably benign	Het
Ranbp2	T	A	10: 58,480,005	D2182E	probably damaging	Het
Sass6	G	A	3: 116,620,103	R485K	probably benign	Het
Scoc	A	T	8: 83,435,942	S68T	probably damaging	Het
Speer3	T	A	5: 13,794,664	L114I	probably damaging	Het
Ss18l1	C	G	2: 180,057,653	Q215E	probably damaging	Het
Stab2	T	C	10: 86,960,279	N368S	probably benign	Het
Trim80	T	A	11: 115,445,078	S275R	probably benign	Het
Tubb5	T	C	17: 35,835,070	N416S	probably benign	Het
Ugt2a3	A	T	5: 87,327,200	M395K	probably damaging	Het
Vmn2r61	T	A	7: 42,266,818	M285K	possibly damaging	Het
Xpo1	A	G	11: 23,294,645	I1008V	probably benign	Het

Other mutations in Gprc5c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01599:Gprc5c	APN	11	114864252	missense	probably benign	0.01
IGL01762:Gprc5c	APN	11	114864024	missense	probably benign	0.28
IGL02039:Gprc5c	APN	11	114864486	nonsense	probably null
R0800:Gprc5c	UTSW	11	114866711	missense	probably damaging	0.99
R1618:Gprc5c	UTSW	11	114864394	missense	possibly damaging	0.88
R4198:Gprc5c	UTSW	11	114863860	missense	probably damaging	1.00
R4807:Gprc5c	UTSW	11	114864498	missense	probably damaging	0.97
R4846:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R4902:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R4904:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5016:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5048:Gprc5c	UTSW	11	114870351	makesense	probably null
R5106:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5109:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5173:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5266:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5267:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5475:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5557:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5562:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5563:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5598:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5599:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5729:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5756:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5792:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5793:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5794:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5817:Gprc5c	UTSW	11	114863624	nonsense	probably null
R5976:Gprc5c	UTSW	11	114864487	missense	possibly damaging	0.89
R6151:Gprc5c	UTSW	11	114864025	missense	probably damaging	1.00
R6617:Gprc5c	UTSW	11	114864105	missense	probably benign	0.05
R7108:Gprc5c	UTSW	11	114864282	missense	probably damaging	1.00
R7191:Gprc5c	UTSW	11	114868617	missense	possibly damaging	0.56
R7796:Gprc5c	UTSW	11	114864532	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- AATGTCAGTGCCGACTCGAC -3'
(R):5'- TCCTTCAGGATGGTCTCATAGCC -3'

Sequencing Primer
(F):5'- GACCATGACCTCTCCGTGTG -3'
(R):5'- GATGGTCTCATAGCCCACCC -3'

Posted On

2016-10-05