Incidental Mutation 'R5508:Pdcd2'
ID431047
Institutional Source Beutler Lab
Gene Symbol Pdcd2
Ensembl Gene ENSMUSG00000014771
Gene Nameprogrammed cell death 2
SynonymsRP-8
MMRRC Submission 043069-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5508 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location15519208-15527301 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 15521739 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 310 (D310N)
Ref Sequence ENSEMBL: ENSMUSP00000052523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014911] [ENSMUST00000054450] [ENSMUST00000117593] [ENSMUST00000118001] [ENSMUST00000153480] [ENSMUST00000154293] [ENSMUST00000162505]
Predicted Effect probably benign
Transcript: ENSMUST00000014911
SMART Domains Protein: ENSMUSP00000014911
Gene: ENSMUSG00000014767

DomainStartEndE-ValueType
low complexity region 55 97 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
low complexity region 117 133 N/A INTRINSIC
Pfam:TBP 138 222 4.3e-34 PFAM
Pfam:TBP 227 313 3.4e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000054450
AA Change: D310N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052523
Gene: ENSMUSG00000014771
AA Change: D310N

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
Pfam:zf-MYND 134 171 2.2e-10 PFAM
Pfam:PDCD2_C 188 338 6e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117593
SMART Domains Protein: ENSMUSP00000112794
Gene: ENSMUSG00000014767

DomainStartEndE-ValueType
low complexity region 55 97 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
low complexity region 117 133 N/A INTRINSIC
Pfam:TBP 138 222 4.3e-34 PFAM
Pfam:TBP 227 313 3.4e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118001
SMART Domains Protein: ENSMUSP00000113999
Gene: ENSMUSG00000014767

DomainStartEndE-ValueType
low complexity region 55 97 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
low complexity region 117 133 N/A INTRINSIC
Pfam:TBP 138 204 1.4e-29 PFAM
Pfam:TBP 203 257 4.4e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125709
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137233
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153480
SMART Domains Protein: ENSMUSP00000114471
Gene: ENSMUSG00000014767

DomainStartEndE-ValueType
Pfam:TBP 30 114 5e-35 PFAM
Pfam:TBP 119 205 4.4e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154293
SMART Domains Protein: ENSMUSP00000118625
Gene: ENSMUSG00000014771

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
Pfam:zf-MYND 134 171 4.3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162505
SMART Domains Protein: ENSMUSP00000124317
Gene: ENSMUSG00000014767

DomainStartEndE-ValueType
low complexity region 55 97 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
low complexity region 117 133 N/A INTRINSIC
Pfam:TBP 139 221 1.1e-34 PFAM
Pfam:TBP 229 312 8.5e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232149
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.7%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein expressed in a variety of tissues. Expression of this gene has been shown to be repressed by B-cell CLL/lymphoma 6 (BCL6), a transcriptional repressor required for lymph node germinal center development, suggesting that BCL6 regulates apoptosis by its effects on this protein. Alternative splicing results in multiple transcript variants and pseudogenes have been identified on chromosomes 9 and 12. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality before implantation with most arresting before the blastocyst satge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,538,084 probably null Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Apc A G 18: 34,298,580 D344G probably damaging Het
Asphd2 A T 5: 112,386,783 F300I probably damaging Het
BC016579 T A 16: 45,633,006 T149S possibly damaging Het
Bcl6b A T 11: 70,226,093 H453Q probably damaging Het
Clec4b2 A G 6: 123,173,042 probably benign Het
Crispld1 G T 1: 17,752,983 C396F probably damaging Het
Dnase1l3 A G 14: 7,968,146 V253A probably damaging Het
Efhd1 A G 1: 87,309,794 *241W probably null Het
Flvcr1 C T 1: 191,025,459 G212D probably damaging Het
Golga2 T A 2: 32,288,187 L36* probably null Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gtf3c2 G T 5: 31,174,461 C4* probably null Het
Kit G T 5: 75,649,548 C786F probably damaging Het
Klf14 T C 6: 30,958,042 H219R probably damaging Het
Large2 A G 2: 92,369,903 V122A possibly damaging Het
Lct G A 1: 128,294,131 A1557V probably damaging Het
Lrp6 T G 6: 134,464,516 K1162N probably benign Het
Mtmr11 G A 3: 96,163,767 R147Q probably damaging Het
Pbld2 T A 10: 63,066,665 probably null Het
Pcdhb3 A T 18: 37,301,126 L48F probably damaging Het
Phlpp1 G T 1: 106,364,390 R993L probably benign Het
Prr36 G A 8: 4,216,488 P21S probably damaging Het
Ptprq C A 10: 107,686,231 V620L probably benign Het
Ranbp2 T A 10: 58,480,005 D2182E probably damaging Het
Sass6 G A 3: 116,620,103 R485K probably benign Het
Scoc A T 8: 83,435,942 S68T probably damaging Het
Speer3 T A 5: 13,794,664 L114I probably damaging Het
Ss18l1 C G 2: 180,057,653 Q215E probably damaging Het
Stab2 T C 10: 86,960,279 N368S probably benign Het
Trim80 T A 11: 115,445,078 S275R probably benign Het
Tubb5 T C 17: 35,835,070 N416S probably benign Het
Ugt2a3 A T 5: 87,327,200 M395K probably damaging Het
Vmn2r61 T A 7: 42,266,818 M285K possibly damaging Het
Xpo1 A G 11: 23,294,645 I1008V probably benign Het
Other mutations in Pdcd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02632:Pdcd2 APN 17 15521792 missense probably damaging 0.99
R0433:Pdcd2 UTSW 17 15526384 missense probably benign 0.37
R1368:Pdcd2 UTSW 17 15526584 missense probably damaging 1.00
R5083:Pdcd2 UTSW 17 15522822 missense possibly damaging 0.50
R5963:Pdcd2 UTSW 17 15526394 missense possibly damaging 0.91
R5963:Pdcd2 UTSW 17 15526395 missense probably damaging 1.00
R6944:Pdcd2 UTSW 17 15525370 missense possibly damaging 0.82
R6993:Pdcd2 UTSW 17 15527081 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGTCACTGGGTACTTGTC -3'
(R):5'- GCCAAGAGAATATTTGAATTCCAGG -3'

Sequencing Primer
(F):5'- CACTGGGTACTTGTCTTAGTAATGC -3'
(R):5'- GGGGCTATAAAGTCAGAGC -3'
Posted On2016-10-05