Incidental Mutation 'R5508:Apc'
ID 431049
Institutional Source Beutler Lab
Gene Symbol Apc
Ensembl Gene ENSMUSG00000005871
Gene Name APC, WNT signaling pathway regulator
Synonyms Min, adenomatosis polyposis coli, CC1
MMRRC Submission 043069-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.970) question?
Stock # R5508 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 34353977-34455605 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34431633 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 344 (D344G)
Ref Sequence ENSEMBL: ENSMUSP00000127131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079362] [ENSMUST00000115781] [ENSMUST00000171187]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000079362
AA Change: D362G

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000078337
Gene: ENSMUSG00000005871
AA Change: D362G

DomainStartEndE-ValueType
Pfam:APC_N_CC 4 55 6e-32 PFAM
low complexity region 92 109 N/A INTRINSIC
Pfam:Suppressor_APC 125 205 2e-24 PFAM
low complexity region 211 222 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
ARM 338 390 6.14e-5 SMART
ARM 457 508 1.62e-4 SMART
ARM 510 551 8.56e-4 SMART
ARM 554 595 4.45e-2 SMART
ARM 597 642 5.76e1 SMART
ARM 647 687 1.29e-7 SMART
Pfam:Arm_APC_u3 730 1017 5e-170 PFAM
Pfam:APC_15aa 1018 1032 1.1e-8 PFAM
Pfam:APC_u5 1034 1133 7.6e-55 PFAM
Pfam:APC_15aa 1154 1168 1.6e-8 PFAM
Pfam:APC_15aa 1171 1185 1.9e-9 PFAM
low complexity region 1187 1204 N/A INTRINSIC
Pfam:APC_crr 1255 1279 1.5e-15 PFAM
Pfam:APC_u9 1280 1367 1.9e-34 PFAM
Pfam:APC_crr 1370 1393 2.2e-10 PFAM
low complexity region 1431 1449 N/A INTRINSIC
Pfam:APC_crr 1485 1509 2.1e-9 PFAM
low complexity region 1532 1548 N/A INTRINSIC
Pfam:SAMP 1568 1587 2.7e-11 PFAM
Pfam:APC_crr 1635 1659 1.9e-15 PFAM
Pfam:APC_u13 1660 1716 1.3e-31 PFAM
Pfam:SAMP 1717 1736 3.2e-12 PFAM
Pfam:APC_u14 1737 1837 1e-46 PFAM
Pfam:APC_crr 1839 1864 6.8e-15 PFAM
Pfam:APC_u15 1865 1945 1.8e-40 PFAM
Pfam:APC_crr 1947 1971 1.6e-14 PFAM
Pfam:APC_crr 2007 2030 1.8e-14 PFAM
Pfam:SAMP 2033 2052 1.6e-13 PFAM
low complexity region 2112 2146 N/A INTRINSIC
Pfam:APC_basic 2223 2579 1.5e-110 PFAM
low complexity region 2626 2638 N/A INTRINSIC
Pfam:EB1_binding 2670 2842 9.3e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115781
AA Change: D328G

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000111447
Gene: ENSMUSG00000005871
AA Change: D328G

DomainStartEndE-ValueType
PDB:1DEB|B 2 55 1e-27 PDB
low complexity region 92 109 N/A INTRINSIC
Pfam:Suppressor_APC 124 206 1.5e-31 PFAM
low complexity region 211 222 N/A INTRINSIC
ARM 304 356 6.14e-5 SMART
ARM 423 474 1.62e-4 SMART
ARM 476 517 8.56e-4 SMART
ARM 520 561 4.45e-2 SMART
ARM 563 608 5.76e1 SMART
ARM 613 653 1.29e-7 SMART
Pfam:Arm 655 695 1.7e-6 PFAM
low complexity region 797 810 N/A INTRINSIC
low complexity region 880 892 N/A INTRINSIC
low complexity region 923 935 N/A INTRINSIC
Pfam:APC_15aa 984 999 3.7e-9 PFAM
Pfam:APC_15aa 1100 1115 8.4e-8 PFAM
Pfam:APC_15aa 1120 1135 9.9e-9 PFAM
Pfam:APC_15aa 1137 1152 1.2e-9 PFAM
low complexity region 1153 1170 N/A INTRINSIC
Pfam:APC_crr 1220 1245 7.5e-15 PFAM
low complexity region 1320 1331 N/A INTRINSIC
Pfam:APC_crr 1334 1359 2.8e-11 PFAM
low complexity region 1397 1415 N/A INTRINSIC
Pfam:APC_crr 1450 1475 2.2e-8 PFAM
low complexity region 1498 1514 N/A INTRINSIC
Pfam:SAMP 1533 1553 8.4e-12 PFAM
Pfam:APC_crr 1600 1625 3.5e-13 PFAM
Pfam:SAMP 1682 1702 5e-12 PFAM
low complexity region 1732 1744 N/A INTRINSIC
Pfam:APC_crr 1805 1830 3.1e-12 PFAM
low complexity region 1866 1877 N/A INTRINSIC
Pfam:APC_crr 1912 1937 3.5e-13 PFAM
Pfam:APC_crr 1971 1996 7.1e-14 PFAM
Pfam:SAMP 1999 2018 4.6e-13 PFAM
low complexity region 2078 2112 N/A INTRINSIC
Pfam:APC_basic 2189 2545 1.1e-131 PFAM
low complexity region 2592 2604 N/A INTRINSIC
Pfam:EB1_binding 2636 2808 2.9e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165590
SMART Domains Protein: ENSMUSP00000128327
Gene: ENSMUSG00000005871

DomainStartEndE-ValueType
PDB:3AU3|A 2 33 2e-17 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170023
Predicted Effect probably damaging
Transcript: ENSMUST00000171187
AA Change: D344G

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127131
Gene: ENSMUSG00000005871
AA Change: D344G

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
low complexity region 23 52 N/A INTRINSIC
low complexity region 102 119 N/A INTRINSIC
Pfam:Suppressor_APC 134 216 5.2e-32 PFAM
ARM 320 372 6.14e-5 SMART
ARM 439 490 1.62e-4 SMART
ARM 492 533 8.56e-4 SMART
ARM 536 577 4.45e-2 SMART
ARM 579 624 5.76e1 SMART
ARM 629 669 1.29e-7 SMART
Pfam:Arm 671 711 6.3e-7 PFAM
low complexity region 813 826 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
Pfam:APC_15aa 1000 1015 1.4e-9 PFAM
Pfam:APC_15aa 1116 1131 3.1e-8 PFAM
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.7%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tumor suppressor protein that acts as an antagonist of the Wnt signaling pathway. It is also involved in other processes including cell migration and adhesion, transcriptional activation, and apoptosis. Defects in this gene cause familial adenomatous polyposis (FAP), an autosomal dominant pre-malignant disease that usually progresses to malignancy. Disease-associated mutations tend to be clustered in a small region designated the mutation cluster region (MCR) and result in a truncated protein product. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most targeted and hypomorphic heterozygous mutants develop intestinal polyps and colorectal cancer, associated with anemia from intestinal bleeding. Homozygotes are embryonic lethal. Homozygotes for a mild alleles survive and have less extreme tumor incidence. [provided by MGI curators]
Allele List at MGI

All alleles(88) : Targeted(25) Gene trapped(62) Chemically induced(1)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 69,838,395 (GRCm39) R1566K possibly damaging Het
Asphd2 A T 5: 112,534,649 (GRCm39) F300I probably damaging Het
BC016579 T A 16: 45,453,369 (GRCm39) T149S possibly damaging Het
Bcl6b A T 11: 70,116,919 (GRCm39) H453Q probably damaging Het
Ccdc192 G A 18: 57,671,156 (GRCm39) probably null Het
Clec4b2 A G 6: 123,150,001 (GRCm39) probably benign Het
Crispld1 G T 1: 17,823,207 (GRCm39) C396F probably damaging Het
Dnase1l3 A G 14: 7,968,146 (GRCm38) V253A probably damaging Het
Efhd1 A G 1: 87,237,516 (GRCm39) *241W probably null Het
Flvcr1 C T 1: 190,757,656 (GRCm39) G212D probably damaging Het
Golga2 T A 2: 32,178,199 (GRCm39) L36* probably null Het
Gprc5c G T 11: 114,755,093 (GRCm39) V257L possibly damaging Het
Gtf3c2 G T 5: 31,331,805 (GRCm39) C4* probably null Het
Kit G T 5: 75,810,208 (GRCm39) C786F probably damaging Het
Klf14 T C 6: 30,934,977 (GRCm39) H219R probably damaging Het
Large2 A G 2: 92,200,248 (GRCm39) V122A possibly damaging Het
Lct G A 1: 128,221,868 (GRCm39) A1557V probably damaging Het
Lrp6 T G 6: 134,441,479 (GRCm39) K1162N probably benign Het
Mtmr11 G A 3: 96,071,084 (GRCm39) R147Q probably damaging Het
Pbld2 T A 10: 62,902,444 (GRCm39) probably null Het
Pcdhb3 A T 18: 37,434,179 (GRCm39) L48F probably damaging Het
Pdcd2 C T 17: 15,742,001 (GRCm39) D310N probably damaging Het
Phlpp1 G T 1: 106,292,120 (GRCm39) R993L probably benign Het
Prr36 G A 8: 4,266,488 (GRCm39) P21S probably damaging Het
Ptprq C A 10: 107,522,092 (GRCm39) V620L probably benign Het
Ranbp2 T A 10: 58,315,827 (GRCm39) D2182E probably damaging Het
Sass6 G A 3: 116,413,752 (GRCm39) R485K probably benign Het
Scoc A T 8: 84,162,571 (GRCm39) S68T probably damaging Het
Speer3 T A 5: 13,844,678 (GRCm39) L114I probably damaging Het
Ss18l1 C G 2: 179,699,446 (GRCm39) Q215E probably damaging Het
Stab2 T C 10: 86,796,143 (GRCm39) N368S probably benign Het
Trim80 T A 11: 115,335,904 (GRCm39) S275R probably benign Het
Tubb5 T C 17: 36,145,962 (GRCm39) N416S probably benign Het
Ugt2a3 A T 5: 87,475,059 (GRCm39) M395K probably damaging Het
Vmn2r61 T A 7: 41,916,242 (GRCm39) M285K possibly damaging Het
Xpo1 A G 11: 23,244,645 (GRCm39) I1008V probably benign Het
Other mutations in Apc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Apc APN 18 34,449,979 (GRCm39) missense probably benign 0.01
IGL00898:Apc APN 18 34,450,147 (GRCm39) missense probably damaging 1.00
IGL01111:Apc APN 18 34,448,189 (GRCm39) missense possibly damaging 0.95
IGL01347:Apc APN 18 34,450,723 (GRCm39) missense probably damaging 1.00
IGL01375:Apc APN 18 34,446,707 (GRCm39) missense probably damaging 1.00
IGL01805:Apc APN 18 34,451,271 (GRCm39) missense probably benign 0.02
IGL01997:Apc APN 18 34,448,476 (GRCm39) missense probably benign 0.00
IGL02033:Apc APN 18 34,443,772 (GRCm39) missense probably damaging 1.00
IGL02323:Apc APN 18 34,448,863 (GRCm39) nonsense probably null
IGL02373:Apc APN 18 34,449,212 (GRCm39) missense probably damaging 1.00
IGL02379:Apc APN 18 34,431,798 (GRCm39) missense probably benign 0.45
IGL02456:Apc APN 18 34,446,935 (GRCm39) nonsense probably null
IGL02552:Apc APN 18 34,446,035 (GRCm39) missense possibly damaging 0.90
IGL02676:Apc APN 18 34,448,687 (GRCm39) missense probably damaging 1.00
IGL02756:Apc APN 18 34,447,588 (GRCm39) missense probably damaging 1.00
IGL02938:Apc APN 18 34,448,281 (GRCm39) missense probably damaging 0.98
IGL02974:Apc APN 18 34,401,436 (GRCm39) splice site probably benign
IGL03124:Apc APN 18 34,433,038 (GRCm39) missense probably damaging 0.98
IGL03201:Apc APN 18 34,445,429 (GRCm39) missense probably damaging 1.00
IGL03339:Apc APN 18 34,431,527 (GRCm39) missense probably damaging 1.00
FR4304:Apc UTSW 18 34,415,050 (GRCm39) intron probably benign
FR4342:Apc UTSW 18 34,415,052 (GRCm39) intron probably benign
FR4449:Apc UTSW 18 34,415,058 (GRCm39) intron probably benign
FR4449:Apc UTSW 18 34,415,053 (GRCm39) intron probably benign
FR4548:Apc UTSW 18 34,415,051 (GRCm39) intron probably benign
FR4737:Apc UTSW 18 34,415,052 (GRCm39) intron probably benign
FR4976:Apc UTSW 18 34,415,057 (GRCm39) nonsense probably null
FR4976:Apc UTSW 18 34,415,053 (GRCm39) intron probably benign
FR4976:Apc UTSW 18 34,415,051 (GRCm39) intron probably benign
R0385:Apc UTSW 18 34,448,997 (GRCm39) missense probably damaging 1.00
R0535:Apc UTSW 18 34,394,125 (GRCm39) missense probably damaging 1.00
R0561:Apc UTSW 18 34,446,356 (GRCm39) missense possibly damaging 0.94
R0590:Apc UTSW 18 34,449,283 (GRCm39) nonsense probably null
R0626:Apc UTSW 18 34,451,507 (GRCm39) missense probably damaging 1.00
R0991:Apc UTSW 18 34,449,160 (GRCm39) missense probably damaging 1.00
R1564:Apc UTSW 18 34,448,202 (GRCm39) missense probably benign 0.00
R1663:Apc UTSW 18 34,401,378 (GRCm39) missense probably damaging 0.98
R1737:Apc UTSW 18 34,450,075 (GRCm39) missense probably damaging 1.00
R1739:Apc UTSW 18 34,445,371 (GRCm39) missense probably damaging 1.00
R1835:Apc UTSW 18 34,450,130 (GRCm39) missense probably damaging 1.00
R1887:Apc UTSW 18 34,405,521 (GRCm39) missense probably damaging 1.00
R1957:Apc UTSW 18 34,450,388 (GRCm39) missense probably damaging 1.00
R1974:Apc UTSW 18 34,433,057 (GRCm39) missense possibly damaging 0.62
R2005:Apc UTSW 18 34,443,962 (GRCm39) critical splice donor site probably null
R2013:Apc UTSW 18 34,448,644 (GRCm39) missense probably damaging 0.98
R2014:Apc UTSW 18 34,448,644 (GRCm39) missense probably damaging 0.98
R2015:Apc UTSW 18 34,448,644 (GRCm39) missense probably damaging 0.98
R2017:Apc UTSW 18 34,446,655 (GRCm39) missense probably benign 0.00
R2056:Apc UTSW 18 34,449,481 (GRCm39) missense probably damaging 1.00
R2108:Apc UTSW 18 34,402,282 (GRCm39) missense probably damaging 1.00
R2120:Apc UTSW 18 34,409,654 (GRCm39) missense probably damaging 1.00
R2131:Apc UTSW 18 34,445,098 (GRCm39) missense possibly damaging 0.51
R2133:Apc UTSW 18 34,445,098 (GRCm39) missense possibly damaging 0.51
R2291:Apc UTSW 18 34,445,544 (GRCm39) missense probably benign 0.45
R2332:Apc UTSW 18 34,450,112 (GRCm39) missense possibly damaging 0.50
R2360:Apc UTSW 18 34,394,179 (GRCm39) missense probably damaging 1.00
R2407:Apc UTSW 18 34,447,315 (GRCm39) missense possibly damaging 0.77
R2507:Apc UTSW 18 34,449,590 (GRCm39) missense possibly damaging 0.77
R2940:Apc UTSW 18 34,409,723 (GRCm39) missense probably damaging 1.00
R3404:Apc UTSW 18 34,446,655 (GRCm39) missense probably benign 0.00
R3411:Apc UTSW 18 34,402,312 (GRCm39) splice site probably benign
R3778:Apc UTSW 18 34,446,134 (GRCm39) missense probably damaging 1.00
R3826:Apc UTSW 18 34,412,388 (GRCm39) missense possibly damaging 0.93
R4599:Apc UTSW 18 34,451,040 (GRCm39) nonsense probably null
R4611:Apc UTSW 18 34,451,618 (GRCm39) missense probably damaging 1.00
R4664:Apc UTSW 18 34,431,647 (GRCm39) missense probably damaging 0.98
R4969:Apc UTSW 18 34,445,971 (GRCm39) nonsense probably null
R5007:Apc UTSW 18 34,446,016 (GRCm39) missense probably damaging 1.00
R5066:Apc UTSW 18 34,449,158 (GRCm39) missense probably damaging 1.00
R5112:Apc UTSW 18 34,449,162 (GRCm39) nonsense probably null
R5259:Apc UTSW 18 34,447,343 (GRCm39) missense probably benign 0.29
R5440:Apc UTSW 18 34,354,213 (GRCm39) unclassified probably benign
R5512:Apc UTSW 18 34,443,962 (GRCm39) critical splice donor site probably benign
R5850:Apc UTSW 18 34,451,116 (GRCm39) missense possibly damaging 0.94
R5951:Apc UTSW 18 34,450,199 (GRCm39) missense possibly damaging 0.89
R5966:Apc UTSW 18 34,354,140 (GRCm39) utr 5 prime probably benign
R6081:Apc UTSW 18 34,423,164 (GRCm39) missense possibly damaging 0.93
R6116:Apc UTSW 18 34,449,508 (GRCm39) missense probably damaging 1.00
R6351:Apc UTSW 18 34,445,265 (GRCm39) missense probably damaging 1.00
R6354:Apc UTSW 18 34,445,581 (GRCm39) missense probably benign 0.02
R6467:Apc UTSW 18 34,402,252 (GRCm39) missense probably benign 0.22
R6974:Apc UTSW 18 34,431,480 (GRCm39) missense possibly damaging 0.65
R7027:Apc UTSW 18 34,445,129 (GRCm39) missense probably damaging 1.00
R7096:Apc UTSW 18 34,449,010 (GRCm39) missense probably damaging 1.00
R7289:Apc UTSW 18 34,448,324 (GRCm39) missense probably damaging 1.00
R7439:Apc UTSW 18 34,445,126 (GRCm39) missense probably damaging 1.00
R7441:Apc UTSW 18 34,445,126 (GRCm39) missense probably damaging 1.00
R7534:Apc UTSW 18 34,450,015 (GRCm39) missense probably damaging 1.00
R7685:Apc UTSW 18 34,447,261 (GRCm39) missense probably damaging 1.00
R7814:Apc UTSW 18 34,405,592 (GRCm39) missense probably damaging 0.98
R7954:Apc UTSW 18 34,447,321 (GRCm39) missense probably damaging 0.99
R8352:Apc UTSW 18 34,445,804 (GRCm39) missense possibly damaging 0.54
R8452:Apc UTSW 18 34,445,804 (GRCm39) missense possibly damaging 0.54
R8497:Apc UTSW 18 34,446,083 (GRCm39) missense possibly damaging 0.81
R8545:Apc UTSW 18 34,450,084 (GRCm39) missense possibly damaging 0.94
R8554:Apc UTSW 18 34,445,999 (GRCm39) missense probably damaging 1.00
R8955:Apc UTSW 18 34,401,370 (GRCm39) missense probably damaging 1.00
R9014:Apc UTSW 18 34,354,074 (GRCm39) start gained probably benign
R9061:Apc UTSW 18 34,446,251 (GRCm39) missense probably damaging 1.00
R9147:Apc UTSW 18 34,450,710 (GRCm39) missense probably damaging 1.00
R9318:Apc UTSW 18 34,447,040 (GRCm39) missense possibly damaging 0.69
R9521:Apc UTSW 18 34,445,738 (GRCm39) missense probably benign 0.24
R9546:Apc UTSW 18 34,445,311 (GRCm39) missense possibly damaging 0.86
R9547:Apc UTSW 18 34,445,311 (GRCm39) missense possibly damaging 0.86
R9557:Apc UTSW 18 34,451,412 (GRCm39) missense probably damaging 1.00
R9592:Apc UTSW 18 34,443,823 (GRCm39) nonsense probably null
R9675:Apc UTSW 18 34,449,247 (GRCm39) missense probably damaging 1.00
R9736:Apc UTSW 18 34,450,823 (GRCm39) missense probably damaging 1.00
R9792:Apc UTSW 18 34,447,628 (GRCm39) missense probably damaging 1.00
R9793:Apc UTSW 18 34,447,628 (GRCm39) missense probably damaging 1.00
R9795:Apc UTSW 18 34,447,628 (GRCm39) missense probably damaging 1.00
RF046:Apc UTSW 18 34,415,062 (GRCm39) critical splice donor site probably benign
RF063:Apc UTSW 18 34,415,062 (GRCm39) critical splice donor site probably benign
X0021:Apc UTSW 18 34,445,161 (GRCm39) missense probably damaging 1.00
X0025:Apc UTSW 18 34,445,429 (GRCm39) missense probably damaging 1.00
Z1088:Apc UTSW 18 34,446,220 (GRCm39) nonsense probably null
Z1177:Apc UTSW 18 34,447,516 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACTCATTTGGCCCACAGGTG -3'
(R):5'- GCACACTATAAAGAACATACTTGGG -3'

Sequencing Primer
(F):5'- CACAGGTGGAAATGGTGTATTCC -3'
(R):5'- AGAACATACTTGGGTTTTTGTCC -3'
Posted On 2016-10-05