Incidental Mutation 'R5509:Magi3'
ID431062
Institutional Source Beutler Lab
Gene Symbol Magi3
Ensembl Gene ENSMUSG00000052539
Gene Namemembrane associated guanylate kinase, WW and PDZ domain containing 3
Synonyms4732496O19Rik, 6530407C02Rik
MMRRC Submission 043070-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.456) question?
Stock #R5509 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location104013259-104220374 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104015502 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1300 (S1300T)
Ref Sequence ENSEMBL: ENSMUSP00000112934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064371] [ENSMUST00000121198] [ENSMUST00000122303] [ENSMUST00000145727]
Predicted Effect probably benign
Transcript: ENSMUST00000064371
SMART Domains Protein: ENSMUSP00000067932
Gene: ENSMUSG00000052539

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121198
AA Change: S1300T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000112934
Gene: ENSMUSG00000052539
AA Change: S1300T

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122303
SMART Domains Protein: ENSMUSP00000113713
Gene: ENSMUSG00000052539

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145727
SMART Domains Protein: ENSMUSP00000114722
Gene: ENSMUSG00000058388

DomainStartEndE-ValueType
Pfam:Phtf-FEM1B_bdg 3 158 1.6e-88 PFAM
low complexity region 170 181 N/A INTRINSIC
low complexity region 347 370 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 512 534 N/A INTRINSIC
transmembrane domain 610 632 N/A INTRINSIC
transmembrane domain 647 664 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 95.5%
  • 20x: 91.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,538,084 probably null Het
Abcc10 G C 17: 46,324,259 Q273E probably benign Het
Acly C T 11: 100,514,979 R329Q probably damaging Het
Acsm2 T C 7: 119,573,617 S152P probably damaging Het
Adamtsl4 A T 3: 95,681,357 I515N probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Atp9a T C 2: 168,639,937 D879G probably damaging Het
Bmp8b G A 4: 123,114,576 D112N possibly damaging Het
Camk2d T C 3: 126,840,316 W496R probably damaging Het
Cflar T C 1: 58,752,392 F285L probably benign Het
Cox16 T C 12: 81,472,258 T176A probably benign Het
Cux1 G T 5: 136,275,317 A1214D probably benign Het
Cyb5d1 C A 11: 69,393,735 probably null Het
Dennd6b G A 15: 89,185,022 P575S probably damaging Het
Fbxl2 A T 9: 113,985,347 probably null Het
Gfpt2 T C 11: 49,827,146 F483L possibly damaging Het
Glrx3 T C 7: 137,445,022 C48R probably damaging Het
Invs G A 4: 48,396,337 V281M probably damaging Het
Kif13a G A 13: 46,752,115 A784V probably benign Het
Kmt2d T C 15: 98,839,676 probably benign Het
Lmod2 A G 6: 24,603,889 T288A probably damaging Het
Lrrc37a T C 11: 103,500,535 K1355E probably benign Het
Mdm2 A C 10: 117,690,612 D307E probably damaging Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Mroh4 T C 15: 74,606,154 Y901C probably benign Het
Mtmr14 G T 6: 113,253,807 probably null Het
Mug2 A T 6: 122,084,381 Q1420L possibly damaging Het
Net1 T C 13: 3,884,320 Q459R probably benign Het
Nle1 T C 11: 82,903,182 R343G possibly damaging Het
Npat C A 9: 53,570,242 N1083K probably benign Het
Nrp1 G A 8: 128,425,915 G202R possibly damaging Het
Nsun4 C T 4: 116,051,777 V529I possibly damaging Het
Olfr1427 T A 19: 12,098,977 I221F possibly damaging Het
Olfr1472 A T 19: 13,453,968 L183Q probably damaging Het
Olfr32 T A 2: 90,138,892 L82F probably damaging Het
Olfr935 T C 9: 38,994,628 D269G probably benign Het
Podxl A T 6: 31,526,613 N264K probably benign Het
Ptprm C T 17: 66,689,358 A1245T probably damaging Het
Rdh12 T A 12: 79,210,784 probably null Het
Ryr2 T A 13: 11,745,601 Y1532F probably damaging Het
Senp2 T C 16: 22,040,522 F441S probably damaging Het
Snap23 C A 2: 120,594,865 P111T probably benign Het
Sox2 A G 3: 34,650,789 D125G probably damaging Het
Syne2 T C 12: 75,921,244 W923R probably damaging Het
Tbc1d2b T C 9: 90,218,969 E656G probably damaging Het
Tbcd A G 11: 121,602,012 T892A probably benign Het
Tg A G 15: 66,827,293 I24V probably benign Het
Trpm3 A T 19: 22,987,258 K1372N probably damaging Het
Ubc A T 5: 125,387,275 N329K probably benign Het
Vmn2r106 T A 17: 20,278,422 H409L probably damaging Het
Wdfy3 T A 5: 101,861,448 N2751Y possibly damaging Het
Zfp518a T A 19: 40,915,401 I1258K possibly damaging Het
Zfp91 T C 19: 12,779,087 E131G probably damaging Het
Zfyve26 T A 12: 79,246,521 R2027W probably damaging Het
Other mutations in Magi3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Magi3 APN 3 104014978 missense probably damaging 1.00
IGL00933:Magi3 APN 3 104015847 missense probably benign
IGL01151:Magi3 APN 3 104051374 missense probably damaging 1.00
IGL01674:Magi3 APN 3 104105721 splice site probably benign
IGL01790:Magi3 APN 3 104085244 missense probably damaging 1.00
IGL01903:Magi3 APN 3 104051210 missense possibly damaging 0.87
IGL01939:Magi3 APN 3 104054462 missense probably damaging 0.99
IGL02142:Magi3 APN 3 104015903 missense probably benign 0.32
IGL02183:Magi3 APN 3 104085347 missense probably benign 0.01
IGL02887:Magi3 APN 3 104095157 missense probably damaging 1.00
IGL03071:Magi3 APN 3 104015886 missense possibly damaging 0.51
IGL03085:Magi3 APN 3 104015339 missense possibly damaging 0.88
IGL03192:Magi3 APN 3 104043246 missense probably damaging 1.00
IGL03204:Magi3 APN 3 104105835 missense probably damaging 1.00
IGL03227:Magi3 APN 3 104051119 missense probably benign
IGL03388:Magi3 APN 3 104015841 missense probably benign 0.30
PIT4280001:Magi3 UTSW 3 104054352 missense probably damaging 1.00
PIT4504001:Magi3 UTSW 3 104015526 missense probably benign 0.05
R0092:Magi3 UTSW 3 104050964 nonsense probably null
R0514:Magi3 UTSW 3 104015022 missense probably damaging 1.00
R0569:Magi3 UTSW 3 104016042 missense probably benign 0.43
R0608:Magi3 UTSW 3 104017557 missense probably damaging 1.00
R0920:Magi3 UTSW 3 104034191 splice site probably null
R1173:Magi3 UTSW 3 104061630 critical splice donor site probably null
R1256:Magi3 UTSW 3 104027810 missense probably benign 0.08
R1391:Magi3 UTSW 3 104015058 nonsense probably null
R1559:Magi3 UTSW 3 104046853 splice site probably benign
R1568:Magi3 UTSW 3 104089527 missense probably benign 0.02
R1631:Magi3 UTSW 3 104051177 missense probably benign 0.05
R1747:Magi3 UTSW 3 104034173 missense possibly damaging 0.82
R1930:Magi3 UTSW 3 104089604 missense probably damaging 1.00
R1964:Magi3 UTSW 3 104020402 missense probably damaging 0.99
R2151:Magi3 UTSW 3 104046882 missense probably damaging 1.00
R2151:Magi3 UTSW 3 104085238 missense probably damaging 1.00
R2266:Magi3 UTSW 3 104021066 intron probably benign
R2267:Magi3 UTSW 3 104021066 intron probably benign
R2268:Magi3 UTSW 3 104021066 intron probably benign
R2519:Magi3 UTSW 3 104015765 missense probably benign 0.00
R3104:Magi3 UTSW 3 104051320 missense probably damaging 0.99
R3105:Magi3 UTSW 3 104051320 missense probably damaging 0.99
R3619:Magi3 UTSW 3 104054405 missense probably damaging 1.00
R4158:Magi3 UTSW 3 104050961 missense probably damaging 1.00
R4160:Magi3 UTSW 3 104050961 missense probably damaging 1.00
R4284:Magi3 UTSW 3 104015868 nonsense probably null
R4285:Magi3 UTSW 3 104015868 nonsense probably null
R4397:Magi3 UTSW 3 104219714 missense probably damaging 1.00
R4512:Magi3 UTSW 3 104089555 missense probably damaging 0.99
R4676:Magi3 UTSW 3 104015825 missense probably benign
R4758:Magi3 UTSW 3 104015321 missense probably benign 0.01
R4940:Magi3 UTSW 3 104051392 missense probably damaging 1.00
R5039:Magi3 UTSW 3 104105791 missense probably damaging 1.00
R5160:Magi3 UTSW 3 104027908 missense possibly damaging 0.46
R5422:Magi3 UTSW 3 104051368 missense probably damaging 1.00
R5839:Magi3 UTSW 3 104219731 missense probably damaging 1.00
R5924:Magi3 UTSW 3 104054538 splice site probably null
R6018:Magi3 UTSW 3 104105812 missense probably damaging 1.00
R6189:Magi3 UTSW 3 104050865 missense probably damaging 1.00
R6235:Magi3 UTSW 3 104016068 missense probably damaging 0.99
R6244:Magi3 UTSW 3 104015697 missense probably benign 0.16
R6258:Magi3 UTSW 3 104089596 missense probably damaging 1.00
R6358:Magi3 UTSW 3 104050952 missense probably damaging 1.00
R6534:Magi3 UTSW 3 104085220 missense possibly damaging 0.75
R6806:Magi3 UTSW 3 104046969 missense possibly damaging 0.94
R6816:Magi3 UTSW 3 104089911 intron probably null
R6897:Magi3 UTSW 3 104089557 missense probably damaging 1.00
R7011:Magi3 UTSW 3 104105754 missense probably damaging 1.00
R7039:Magi3 UTSW 3 104051383 missense probably damaging 1.00
R7196:Magi3 UTSW 3 104049168 missense probably benign 0.01
R7237:Magi3 UTSW 3 104027911 missense probably damaging 1.00
R7285:Magi3 UTSW 3 104034114 missense probably benign 0.00
R7709:Magi3 UTSW 3 104034038 missense probably damaging 1.00
R7724:Magi3 UTSW 3 104015927 missense probably benign 0.04
R7797:Magi3 UTSW 3 104051302 missense probably damaging 1.00
X0026:Magi3 UTSW 3 104020420 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GATACTACCCTACCAGCAGTGC -3'
(R):5'- CCGACATTCAGAGGAACATTTGG -3'

Sequencing Primer
(F):5'- TGGATGGGAGAGATGTTTCATCAAC -3'
(R):5'- GATTCCCAGGCCCCTAAAAAGTG -3'
Posted On2016-10-05