Incidental Mutation 'R5509:Mtmr14'
ID431073
Institutional Source Beutler Lab
Gene Symbol Mtmr14
Ensembl Gene ENSMUSG00000030269
Gene Namemyotubularin related protein 14
Synonyms
MMRRC Submission 043070-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R5509 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location113237843-113281392 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 113253807 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113146] [ENSMUST00000129883] [ENSMUST00000142938] [ENSMUST00000156141] [ENSMUST00000156141] [ENSMUST00000203385]
Predicted Effect probably null
Transcript: ENSMUST00000113146
SMART Domains Protein: ENSMUSP00000108771
Gene: ENSMUSG00000030269

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
Blast:C2 605 647 2e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000129883
SMART Domains Protein: ENSMUSP00000114575
Gene: ENSMUSG00000030269

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142938
SMART Domains Protein: ENSMUSP00000121136
Gene: ENSMUSG00000030269

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144976
Predicted Effect probably null
Transcript: ENSMUST00000156141
Predicted Effect probably null
Transcript: ENSMUST00000156141
Predicted Effect probably benign
Transcript: ENSMUST00000203385
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 95.5%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a myotubularin-related protein. The encoded protein is a phosphoinositide phosphatase that specifically dephosphorylates phosphatidylinositol 3,5-biphosphate and phosphatidylinositol 3-phosphate. Mutations in this gene are correlated with autosomal dominant centronuclear myopathy. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 18.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired coordination, decreased exercise endurance, increased muscle fatigue, and muscle atrophy associated with impaired muscular calcium homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,538,084 probably null Het
Abcc10 G C 17: 46,324,259 Q273E probably benign Het
Acly C T 11: 100,514,979 R329Q probably damaging Het
Acsm2 T C 7: 119,573,617 S152P probably damaging Het
Adamtsl4 A T 3: 95,681,357 I515N probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Atp9a T C 2: 168,639,937 D879G probably damaging Het
Bmp8b G A 4: 123,114,576 D112N possibly damaging Het
Camk2d T C 3: 126,840,316 W496R probably damaging Het
Cflar T C 1: 58,752,392 F285L probably benign Het
Cox16 T C 12: 81,472,258 T176A probably benign Het
Cux1 G T 5: 136,275,317 A1214D probably benign Het
Cyb5d1 C A 11: 69,393,735 probably null Het
Dennd6b G A 15: 89,185,022 P575S probably damaging Het
Fbxl2 A T 9: 113,985,347 probably null Het
Gfpt2 T C 11: 49,827,146 F483L possibly damaging Het
Glrx3 T C 7: 137,445,022 C48R probably damaging Het
Invs G A 4: 48,396,337 V281M probably damaging Het
Kif13a G A 13: 46,752,115 A784V probably benign Het
Kmt2d T C 15: 98,839,676 probably benign Het
Lmod2 A G 6: 24,603,889 T288A probably damaging Het
Lrrc37a T C 11: 103,500,535 K1355E probably benign Het
Magi3 A T 3: 104,015,502 S1300T probably benign Het
Mdm2 A C 10: 117,690,612 D307E probably damaging Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Mroh4 T C 15: 74,606,154 Y901C probably benign Het
Mug2 A T 6: 122,084,381 Q1420L possibly damaging Het
Net1 T C 13: 3,884,320 Q459R probably benign Het
Nle1 T C 11: 82,903,182 R343G possibly damaging Het
Npat C A 9: 53,570,242 N1083K probably benign Het
Nrp1 G A 8: 128,425,915 G202R possibly damaging Het
Nsun4 C T 4: 116,051,777 V529I possibly damaging Het
Olfr1427 T A 19: 12,098,977 I221F possibly damaging Het
Olfr1472 A T 19: 13,453,968 L183Q probably damaging Het
Olfr32 T A 2: 90,138,892 L82F probably damaging Het
Olfr935 T C 9: 38,994,628 D269G probably benign Het
Podxl A T 6: 31,526,613 N264K probably benign Het
Ptprm C T 17: 66,689,358 A1245T probably damaging Het
Rdh12 T A 12: 79,210,784 probably null Het
Ryr2 T A 13: 11,745,601 Y1532F probably damaging Het
Senp2 T C 16: 22,040,522 F441S probably damaging Het
Snap23 C A 2: 120,594,865 P111T probably benign Het
Sox2 A G 3: 34,650,789 D125G probably damaging Het
Syne2 T C 12: 75,921,244 W923R probably damaging Het
Tbc1d2b T C 9: 90,218,969 E656G probably damaging Het
Tbcd A G 11: 121,602,012 T892A probably benign Het
Tg A G 15: 66,827,293 I24V probably benign Het
Trpm3 A T 19: 22,987,258 K1372N probably damaging Het
Ubc A T 5: 125,387,275 N329K probably benign Het
Vmn2r106 T A 17: 20,278,422 H409L probably damaging Het
Wdfy3 T A 5: 101,861,448 N2751Y possibly damaging Het
Zfp518a T A 19: 40,915,401 I1258K possibly damaging Het
Zfp91 T C 19: 12,779,087 E131G probably damaging Het
Zfyve26 T A 12: 79,246,521 R2027W probably damaging Het
Other mutations in Mtmr14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Mtmr14 APN 6 113266326 missense probably damaging 0.98
IGL01686:Mtmr14 APN 6 113240430 missense possibly damaging 0.58
IGL02508:Mtmr14 APN 6 113240306 missense probably damaging 1.00
R0147:Mtmr14 UTSW 6 113260666 splice site probably benign
R0394:Mtmr14 UTSW 6 113280688 nonsense probably null
R0529:Mtmr14 UTSW 6 113266252 unclassified probably benign
R0675:Mtmr14 UTSW 6 113270647 missense probably damaging 0.99
R0723:Mtmr14 UTSW 6 113270512 unclassified probably benign
R0785:Mtmr14 UTSW 6 113277947 critical splice donor site probably null
R0866:Mtmr14 UTSW 6 113239582 critical splice donor site probably null
R1721:Mtmr14 UTSW 6 113253732 missense probably damaging 1.00
R1998:Mtmr14 UTSW 6 113277924 missense probably null
R2063:Mtmr14 UTSW 6 113240361 missense probably damaging 1.00
R2192:Mtmr14 UTSW 6 113280739 missense probably damaging 1.00
R2656:Mtmr14 UTSW 6 113240366 missense probably benign 0.03
R4648:Mtmr14 UTSW 6 113260606 missense probably benign 0.12
R5209:Mtmr14 UTSW 6 113253775 nonsense probably null
R5569:Mtmr14 UTSW 6 113240285 missense probably damaging 0.96
R5589:Mtmr14 UTSW 6 113261282 critical splice donor site probably null
R5924:Mtmr14 UTSW 6 113253789 missense probably damaging 1.00
R5997:Mtmr14 UTSW 6 113280614 missense probably damaging 0.97
R6182:Mtmr14 UTSW 6 113269508 missense possibly damaging 0.78
R6658:Mtmr14 UTSW 6 113265476 nonsense probably null
R6752:Mtmr14 UTSW 6 113240397 missense probably damaging 1.00
R7325:Mtmr14 UTSW 6 113269548 missense probably damaging 0.98
R7512:Mtmr14 UTSW 6 113268691 nonsense probably null
R7816:Mtmr14 UTSW 6 113266302 missense probably damaging 1.00
X0023:Mtmr14 UTSW 6 113261255 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTAAGCAGACTTGAGACTGAC -3'
(R):5'- CAAGTCTCCATTAGGGCCAC -3'

Sequencing Primer
(F):5'- CAGACTTGAGACTGACTGGGGTG -3'
(R):5'- ACGCCCACCTGTGTGTG -3'
Posted On2016-10-05