Incidental Mutation 'R5509:Tbc1d2b'
ID431080
Institutional Source Beutler Lab
Gene Symbol Tbc1d2b
Ensembl Gene ENSMUSG00000037410
Gene NameTBC1 domain family, member 2B
Synonyms1810061M12Rik
MMRRC Submission 043070-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5509 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location90202027-90270804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90218969 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 656 (E656G)
Ref Sequence ENSEMBL: ENSMUSP00000045413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041767]
Predicted Effect probably damaging
Transcript: ENSMUST00000041767
AA Change: E656G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045413
Gene: ENSMUSG00000037410
AA Change: E656G

DomainStartEndE-ValueType
PH 35 141 2.66e-9 SMART
low complexity region 324 334 N/A INTRINSIC
low complexity region 343 356 N/A INTRINSIC
Blast:TBC 358 601 2e-25 BLAST
TBC 661 881 3.75e-60 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120385
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 95.5%
  • 20x: 91.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,538,084 probably null Het
Abcc10 G C 17: 46,324,259 Q273E probably benign Het
Acly C T 11: 100,514,979 R329Q probably damaging Het
Acsm2 T C 7: 119,573,617 S152P probably damaging Het
Adamtsl4 A T 3: 95,681,357 I515N probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Atp9a T C 2: 168,639,937 D879G probably damaging Het
Bmp8b G A 4: 123,114,576 D112N possibly damaging Het
Camk2d T C 3: 126,840,316 W496R probably damaging Het
Cflar T C 1: 58,752,392 F285L probably benign Het
Cox16 T C 12: 81,472,258 T176A probably benign Het
Cux1 G T 5: 136,275,317 A1214D probably benign Het
Cyb5d1 C A 11: 69,393,735 probably null Het
Dennd6b G A 15: 89,185,022 P575S probably damaging Het
Fbxl2 A T 9: 113,985,347 probably null Het
Gfpt2 T C 11: 49,827,146 F483L possibly damaging Het
Glrx3 T C 7: 137,445,022 C48R probably damaging Het
Invs G A 4: 48,396,337 V281M probably damaging Het
Kif13a G A 13: 46,752,115 A784V probably benign Het
Kmt2d T C 15: 98,839,676 probably benign Het
Lmod2 A G 6: 24,603,889 T288A probably damaging Het
Lrrc37a T C 11: 103,500,535 K1355E probably benign Het
Magi3 A T 3: 104,015,502 S1300T probably benign Het
Mdm2 A C 10: 117,690,612 D307E probably damaging Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Mroh4 T C 15: 74,606,154 Y901C probably benign Het
Mtmr14 G T 6: 113,253,807 probably null Het
Mug2 A T 6: 122,084,381 Q1420L possibly damaging Het
Net1 T C 13: 3,884,320 Q459R probably benign Het
Nle1 T C 11: 82,903,182 R343G possibly damaging Het
Npat C A 9: 53,570,242 N1083K probably benign Het
Nrp1 G A 8: 128,425,915 G202R possibly damaging Het
Nsun4 C T 4: 116,051,777 V529I possibly damaging Het
Olfr1427 T A 19: 12,098,977 I221F possibly damaging Het
Olfr1472 A T 19: 13,453,968 L183Q probably damaging Het
Olfr32 T A 2: 90,138,892 L82F probably damaging Het
Olfr935 T C 9: 38,994,628 D269G probably benign Het
Podxl A T 6: 31,526,613 N264K probably benign Het
Ptprm C T 17: 66,689,358 A1245T probably damaging Het
Rdh12 T A 12: 79,210,784 probably null Het
Ryr2 T A 13: 11,745,601 Y1532F probably damaging Het
Senp2 T C 16: 22,040,522 F441S probably damaging Het
Snap23 C A 2: 120,594,865 P111T probably benign Het
Sox2 A G 3: 34,650,789 D125G probably damaging Het
Syne2 T C 12: 75,921,244 W923R probably damaging Het
Tbcd A G 11: 121,602,012 T892A probably benign Het
Tg A G 15: 66,827,293 I24V probably benign Het
Trpm3 A T 19: 22,987,258 K1372N probably damaging Het
Ubc A T 5: 125,387,275 N329K probably benign Het
Vmn2r106 T A 17: 20,278,422 H409L probably damaging Het
Wdfy3 T A 5: 101,861,448 N2751Y possibly damaging Het
Zfp518a T A 19: 40,915,401 I1258K possibly damaging Het
Zfp91 T C 19: 12,779,087 E131G probably damaging Het
Zfyve26 T A 12: 79,246,521 R2027W probably damaging Het
Other mutations in Tbc1d2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Tbc1d2b APN 9 90226209 missense probably benign
IGL00791:Tbc1d2b APN 9 90227428 missense probably benign 0.18
IGL01457:Tbc1d2b APN 9 90205091 missense probably damaging 1.00
IGL01535:Tbc1d2b APN 9 90215473 splice site probably benign
IGL02089:Tbc1d2b APN 9 90222359 missense possibly damaging 0.80
IGL02409:Tbc1d2b APN 9 90222352 missense probably benign 0.00
IGL02799:Tbc1d2b APN 9 90223434 splice site probably benign
IGL03198:Tbc1d2b APN 9 90222457 missense probably damaging 1.00
Leone UTSW 9 90207887 missense probably damaging 1.00
ocelot UTSW 9 90207884 missense probably damaging 1.00
panthera UTSW 9 90226248 missense probably benign
pardo UTSW 9 90219144 missense probably benign 0.13
pardus UTSW 9 90219010 nonsense probably null
roar UTSW 9 90218922 nonsense probably null
R0062:Tbc1d2b UTSW 9 90222302 splice site probably benign
R0062:Tbc1d2b UTSW 9 90222302 splice site probably benign
R0671:Tbc1d2b UTSW 9 90222505 splice site probably benign
R0682:Tbc1d2b UTSW 9 90249862 missense probably benign 0.01
R1074:Tbc1d2b UTSW 9 90222340 missense possibly damaging 0.68
R1075:Tbc1d2b UTSW 9 90222340 missense possibly damaging 0.68
R1140:Tbc1d2b UTSW 9 90226376 missense possibly damaging 0.91
R1892:Tbc1d2b UTSW 9 90218943 missense probably damaging 0.98
R4064:Tbc1d2b UTSW 9 90218922 nonsense probably null
R4541:Tbc1d2b UTSW 9 90205169 missense probably damaging 1.00
R4590:Tbc1d2b UTSW 9 90270500 missense possibly damaging 0.81
R4651:Tbc1d2b UTSW 9 90207887 missense probably damaging 1.00
R4652:Tbc1d2b UTSW 9 90207887 missense probably damaging 1.00
R4971:Tbc1d2b UTSW 9 90218870 missense probably benign 0.00
R5086:Tbc1d2b UTSW 9 90227457 missense probably benign
R5131:Tbc1d2b UTSW 9 90209759 missense probably damaging 1.00
R5205:Tbc1d2b UTSW 9 90207810 missense probably damaging 1.00
R5502:Tbc1d2b UTSW 9 90227443 missense probably benign
R5534:Tbc1d2b UTSW 9 90227506 missense possibly damaging 0.89
R5729:Tbc1d2b UTSW 9 90207872 missense probably benign 0.22
R5735:Tbc1d2b UTSW 9 90222409 missense possibly damaging 0.71
R5847:Tbc1d2b UTSW 9 90209724 missense probably damaging 1.00
R5928:Tbc1d2b UTSW 9 90219144 missense probably benign 0.13
R6595:Tbc1d2b UTSW 9 90226092 missense probably benign 0.02
R6766:Tbc1d2b UTSW 9 90226209 missense probably benign
R7563:Tbc1d2b UTSW 9 90219010 nonsense probably null
R7563:Tbc1d2b UTSW 9 90226248 missense probably benign
R8126:Tbc1d2b UTSW 9 90222316 missense probably benign 0.00
R8162:Tbc1d2b UTSW 9 90207884 missense probably damaging 1.00
X0066:Tbc1d2b UTSW 9 90218658 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGTTCAGGCCTTGGCAGTAG -3'
(R):5'- TACGGGTTTAGGACTGTCCCTG -3'

Sequencing Primer
(F):5'- TGTATGCCCTCCGACGTG -3'
(R):5'- CTGTCCCTGATGATGATGAGGAAG -3'
Posted On2016-10-05