Incidental Mutation 'R5509:Cyb5d1'
ID431086
Institutional Source Beutler Lab
Gene Symbol Cyb5d1
Ensembl Gene ENSMUSG00000044795
Gene Namecytochrome b5 domain containing 1
SynonymsLOC327951
MMRRC Submission 043070-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5509 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69391925-69395631 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 69393735 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050140] [ENSMUST00000051620] [ENSMUST00000094077] [ENSMUST00000108660] [ENSMUST00000144531]
Predicted Effect probably benign
Transcript: ENSMUST00000050140
SMART Domains Protein: ENSMUSP00000055528
Gene: ENSMUSG00000045377

DomainStartEndE-ValueType
transmembrane domain 44 66 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051620
AA Change: R197L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000059709
Gene: ENSMUSG00000044795
AA Change: R197L

DomainStartEndE-ValueType
Cyt-b5 20 92 1.89e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082283
Predicted Effect probably benign
Transcript: ENSMUST00000094077
SMART Domains Protein: ENSMUSP00000091620
Gene: ENSMUSG00000018476

DomainStartEndE-ValueType
low complexity region 29 43 N/A INTRINSIC
low complexity region 54 71 N/A INTRINSIC
SCOP:d1elwa_ 91 152 9e-5 SMART
low complexity region 214 227 N/A INTRINSIC
low complexity region 239 270 N/A INTRINSIC
low complexity region 312 329 N/A INTRINSIC
low complexity region 333 345 N/A INTRINSIC
low complexity region 389 415 N/A INTRINSIC
low complexity region 461 487 N/A INTRINSIC
low complexity region 515 524 N/A INTRINSIC
low complexity region 544 577 N/A INTRINSIC
low complexity region 585 615 N/A INTRINSIC
low complexity region 643 650 N/A INTRINSIC
low complexity region 711 719 N/A INTRINSIC
low complexity region 743 766 N/A INTRINSIC
low complexity region 771 811 N/A INTRINSIC
low complexity region 840 879 N/A INTRINSIC
low complexity region 890 909 N/A INTRINSIC
low complexity region 950 989 N/A INTRINSIC
low complexity region 993 1011 N/A INTRINSIC
low complexity region 1044 1068 N/A INTRINSIC
low complexity region 1284 1317 N/A INTRINSIC
JmjC 1337 1500 1.61e-47 SMART
Blast:JmjC 1536 1600 1e-18 BLAST
Predicted Effect silent
Transcript: ENSMUST00000108660
SMART Domains Protein: ENSMUSP00000104300
Gene: ENSMUSG00000044795

DomainStartEndE-ValueType
Cyt-b5 20 92 1.89e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142126
Predicted Effect probably null
Transcript: ENSMUST00000144531
SMART Domains Protein: ENSMUSP00000123155
Gene: ENSMUSG00000059278

DomainStartEndE-ValueType
low complexity region 18 36 N/A INTRINSIC
Sm 43 114 4.26e-15 SMART
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 95.5%
  • 20x: 91.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,538,084 probably null Het
Abcc10 G C 17: 46,324,259 Q273E probably benign Het
Acly C T 11: 100,514,979 R329Q probably damaging Het
Acsm2 T C 7: 119,573,617 S152P probably damaging Het
Adamtsl4 A T 3: 95,681,357 I515N probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Atp9a T C 2: 168,639,937 D879G probably damaging Het
Bmp8b G A 4: 123,114,576 D112N possibly damaging Het
Camk2d T C 3: 126,840,316 W496R probably damaging Het
Cflar T C 1: 58,752,392 F285L probably benign Het
Cox16 T C 12: 81,472,258 T176A probably benign Het
Cux1 G T 5: 136,275,317 A1214D probably benign Het
Dennd6b G A 15: 89,185,022 P575S probably damaging Het
Fbxl2 A T 9: 113,985,347 probably null Het
Gfpt2 T C 11: 49,827,146 F483L possibly damaging Het
Glrx3 T C 7: 137,445,022 C48R probably damaging Het
Invs G A 4: 48,396,337 V281M probably damaging Het
Kif13a G A 13: 46,752,115 A784V probably benign Het
Kmt2d T C 15: 98,839,676 probably benign Het
Lmod2 A G 6: 24,603,889 T288A probably damaging Het
Lrrc37a T C 11: 103,500,535 K1355E probably benign Het
Magi3 A T 3: 104,015,502 S1300T probably benign Het
Mdm2 A C 10: 117,690,612 D307E probably damaging Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Mroh4 T C 15: 74,606,154 Y901C probably benign Het
Mtmr14 G T 6: 113,253,807 probably null Het
Mug2 A T 6: 122,084,381 Q1420L possibly damaging Het
Net1 T C 13: 3,884,320 Q459R probably benign Het
Nle1 T C 11: 82,903,182 R343G possibly damaging Het
Npat C A 9: 53,570,242 N1083K probably benign Het
Nrp1 G A 8: 128,425,915 G202R possibly damaging Het
Nsun4 C T 4: 116,051,777 V529I possibly damaging Het
Olfr1427 T A 19: 12,098,977 I221F possibly damaging Het
Olfr1472 A T 19: 13,453,968 L183Q probably damaging Het
Olfr32 T A 2: 90,138,892 L82F probably damaging Het
Olfr935 T C 9: 38,994,628 D269G probably benign Het
Podxl A T 6: 31,526,613 N264K probably benign Het
Ptprm C T 17: 66,689,358 A1245T probably damaging Het
Rdh12 T A 12: 79,210,784 probably null Het
Ryr2 T A 13: 11,745,601 Y1532F probably damaging Het
Senp2 T C 16: 22,040,522 F441S probably damaging Het
Snap23 C A 2: 120,594,865 P111T probably benign Het
Sox2 A G 3: 34,650,789 D125G probably damaging Het
Syne2 T C 12: 75,921,244 W923R probably damaging Het
Tbc1d2b T C 9: 90,218,969 E656G probably damaging Het
Tbcd A G 11: 121,602,012 T892A probably benign Het
Tg A G 15: 66,827,293 I24V probably benign Het
Trpm3 A T 19: 22,987,258 K1372N probably damaging Het
Ubc A T 5: 125,387,275 N329K probably benign Het
Vmn2r106 T A 17: 20,278,422 H409L probably damaging Het
Wdfy3 T A 5: 101,861,448 N2751Y possibly damaging Het
Zfp518a T A 19: 40,915,401 I1258K possibly damaging Het
Zfp91 T C 19: 12,779,087 E131G probably damaging Het
Zfyve26 T A 12: 79,246,521 R2027W probably damaging Het
Other mutations in Cyb5d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Cyb5d1 APN 11 69393784 unclassified probably null
IGL01897:Cyb5d1 APN 11 69393761 missense probably benign
IGL02566:Cyb5d1 APN 11 69393768 missense probably benign 0.01
IGL02732:Cyb5d1 APN 11 69393809 splice site probably null
R0025:Cyb5d1 UTSW 11 69394966 splice site probably null
R0760:Cyb5d1 UTSW 11 69395173 missense probably benign
R1195:Cyb5d1 UTSW 11 69394971 critical splice donor site probably null
R1195:Cyb5d1 UTSW 11 69394971 critical splice donor site probably null
R1195:Cyb5d1 UTSW 11 69394971 critical splice donor site probably null
R1907:Cyb5d1 UTSW 11 69394740 missense probably benign 0.32
R2220:Cyb5d1 UTSW 11 69395045 missense probably benign 0.00
R3756:Cyb5d1 UTSW 11 69393832 missense probably damaging 1.00
R4757:Cyb5d1 UTSW 11 69394988 missense probably damaging 0.99
R4994:Cyb5d1 UTSW 11 69393771 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCAGAAAGGCCCAAGAAC -3'
(R):5'- TCCAAGCAGAATTCTAGAGGTGG -3'

Sequencing Primer
(F):5'- AAGAACCACGGACTGATTCTC -3'
(R):5'- CAGAATTCTAGAGGTGGACACTTCTG -3'
Posted On2016-10-05