Incidental Mutation 'R5509:Zfp518a'
ID431113
Institutional Source Beutler Lab
Gene Symbol Zfp518a
Ensembl Gene ENSMUSG00000049164
Gene Namezinc finger protein 518A
Synonyms6330417C12Rik, 2810401C22Rik, Zfp518
MMRRC Submission 043070-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.916) question?
Stock #R5509 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location40894705-40917947 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40915401 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 1258 (I1258K)
Ref Sequence ENSEMBL: ENSMUSP00000055956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050092]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050092
AA Change: I1258K

PolyPhen 2 Score 0.600 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000055956
Gene: ENSMUSG00000049164
AA Change: I1258K

DomainStartEndE-ValueType
ZnF_C2H2 121 146 1.38e2 SMART
ZnF_C2H2 152 174 4.98e-1 SMART
ZnF_C2H2 179 203 6.75e0 SMART
ZnF_C2H2 209 231 4.34e-1 SMART
ZnF_C2H2 236 258 1.33e-1 SMART
ZnF_C2H2 264 287 9.44e-2 SMART
low complexity region 308 319 N/A INTRINSIC
low complexity region 407 418 N/A INTRINSIC
low complexity region 544 563 N/A INTRINSIC
low complexity region 671 680 N/A INTRINSIC
low complexity region 814 825 N/A INTRINSIC
low complexity region 1147 1164 N/A INTRINSIC
low complexity region 1417 1424 N/A INTRINSIC
ZnF_C2H2 1444 1466 1.33e1 SMART
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 95.5%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the krueppel C2H2-type zinc finger protein family. The encoded protein contains five zinc fingers and is likely a nuclear transcriptional regulator. Numerous transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,538,084 probably null Het
Abcc10 G C 17: 46,324,259 Q273E probably benign Het
Acly C T 11: 100,514,979 R329Q probably damaging Het
Acsm2 T C 7: 119,573,617 S152P probably damaging Het
Adamtsl4 A T 3: 95,681,357 I515N probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Atp9a T C 2: 168,639,937 D879G probably damaging Het
Bmp8b G A 4: 123,114,576 D112N possibly damaging Het
Camk2d T C 3: 126,840,316 W496R probably damaging Het
Cflar T C 1: 58,752,392 F285L probably benign Het
Cox16 T C 12: 81,472,258 T176A probably benign Het
Cux1 G T 5: 136,275,317 A1214D probably benign Het
Cyb5d1 C A 11: 69,393,735 probably null Het
Dennd6b G A 15: 89,185,022 P575S probably damaging Het
Fbxl2 A T 9: 113,985,347 probably null Het
Gfpt2 T C 11: 49,827,146 F483L possibly damaging Het
Glrx3 T C 7: 137,445,022 C48R probably damaging Het
Invs G A 4: 48,396,337 V281M probably damaging Het
Kif13a G A 13: 46,752,115 A784V probably benign Het
Kmt2d T C 15: 98,839,676 probably benign Het
Lmod2 A G 6: 24,603,889 T288A probably damaging Het
Lrrc37a T C 11: 103,500,535 K1355E probably benign Het
Magi3 A T 3: 104,015,502 S1300T probably benign Het
Mdm2 A C 10: 117,690,612 D307E probably damaging Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Mroh4 T C 15: 74,606,154 Y901C probably benign Het
Mtmr14 G T 6: 113,253,807 probably null Het
Mug2 A T 6: 122,084,381 Q1420L possibly damaging Het
Net1 T C 13: 3,884,320 Q459R probably benign Het
Nle1 T C 11: 82,903,182 R343G possibly damaging Het
Npat C A 9: 53,570,242 N1083K probably benign Het
Nrp1 G A 8: 128,425,915 G202R possibly damaging Het
Nsun4 C T 4: 116,051,777 V529I possibly damaging Het
Olfr1427 T A 19: 12,098,977 I221F possibly damaging Het
Olfr1472 A T 19: 13,453,968 L183Q probably damaging Het
Olfr32 T A 2: 90,138,892 L82F probably damaging Het
Olfr935 T C 9: 38,994,628 D269G probably benign Het
Podxl A T 6: 31,526,613 N264K probably benign Het
Ptprm C T 17: 66,689,358 A1245T probably damaging Het
Rdh12 T A 12: 79,210,784 probably null Het
Ryr2 T A 13: 11,745,601 Y1532F probably damaging Het
Senp2 T C 16: 22,040,522 F441S probably damaging Het
Snap23 C A 2: 120,594,865 P111T probably benign Het
Sox2 A G 3: 34,650,789 D125G probably damaging Het
Syne2 T C 12: 75,921,244 W923R probably damaging Het
Tbc1d2b T C 9: 90,218,969 E656G probably damaging Het
Tbcd A G 11: 121,602,012 T892A probably benign Het
Tg A G 15: 66,827,293 I24V probably benign Het
Trpm3 A T 19: 22,987,258 K1372N probably damaging Het
Ubc A T 5: 125,387,275 N329K probably benign Het
Vmn2r106 T A 17: 20,278,422 H409L probably damaging Het
Wdfy3 T A 5: 101,861,448 N2751Y possibly damaging Het
Zfp91 T C 19: 12,779,087 E131G probably damaging Het
Zfyve26 T A 12: 79,246,521 R2027W probably damaging Het
Other mutations in Zfp518a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Zfp518a APN 19 40913470 missense probably damaging 0.99
IGL00647:Zfp518a APN 19 40914686 missense probably damaging 1.00
IGL01468:Zfp518a APN 19 40916031 missense probably benign 0.25
IGL02079:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02080:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02437:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02466:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02470:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02471:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02472:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02500:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02537:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02537:Zfp518a APN 19 40915430 missense probably benign 0.05
IGL02546:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02547:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02561:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02568:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02583:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02584:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02586:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02589:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02614:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02732:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02961:Zfp518a APN 19 40915018 missense probably benign 0.44
IGL02985:Zfp518a APN 19 40913667 missense possibly damaging 0.92
R4630_zfp518a_157 UTSW 19 40912979 nonsense probably null
R0137:Zfp518a UTSW 19 40915866 missense probably damaging 1.00
R0218:Zfp518a UTSW 19 40912628 missense probably benign 0.25
R0367:Zfp518a UTSW 19 40912221 missense probably damaging 1.00
R0575:Zfp518a UTSW 19 40912315 missense probably damaging 1.00
R1418:Zfp518a UTSW 19 40914359 missense probably damaging 1.00
R1795:Zfp518a UTSW 19 40915556 missense probably benign 0.05
R1965:Zfp518a UTSW 19 40913510 missense probably benign 0.00
R2076:Zfp518a UTSW 19 40914327 missense probably damaging 1.00
R3796:Zfp518a UTSW 19 40915310 missense probably damaging 1.00
R3799:Zfp518a UTSW 19 40915310 missense probably damaging 1.00
R3807:Zfp518a UTSW 19 40914797 missense possibly damaging 0.90
R3904:Zfp518a UTSW 19 40914920 nonsense probably null
R3959:Zfp518a UTSW 19 40912698 missense probably damaging 1.00
R4630:Zfp518a UTSW 19 40912979 nonsense probably null
R4662:Zfp518a UTSW 19 40911860 missense probably benign 0.01
R4844:Zfp518a UTSW 19 40914896 missense probably damaging 0.99
R4911:Zfp518a UTSW 19 40915528 missense probably benign 0.04
R4934:Zfp518a UTSW 19 40914263 missense probably benign 0.01
R4964:Zfp518a UTSW 19 40915851 missense possibly damaging 0.94
R4966:Zfp518a UTSW 19 40915851 missense possibly damaging 0.94
R5373:Zfp518a UTSW 19 40913510 missense probably benign 0.00
R5374:Zfp518a UTSW 19 40913510 missense probably benign 0.00
R5378:Zfp518a UTSW 19 40915856 missense probably damaging 1.00
R5891:Zfp518a UTSW 19 40912433 missense probably damaging 1.00
R6187:Zfp518a UTSW 19 40915446 missense probably benign 0.03
R6259:Zfp518a UTSW 19 40912781 missense probably benign 0.01
R6260:Zfp518a UTSW 19 40914123 missense probably benign 0.00
R6763:Zfp518a UTSW 19 40913748 missense probably damaging 1.00
R7419:Zfp518a UTSW 19 40913763 missense possibly damaging 0.94
R7448:Zfp518a UTSW 19 40914157 missense possibly damaging 0.70
R7719:Zfp518a UTSW 19 40912768 missense probably benign 0.01
R7753:Zfp518a UTSW 19 40915805 missense possibly damaging 0.47
R8181:Zfp518a UTSW 19 40913971 missense probably damaging 1.00
R8470:Zfp518a UTSW 19 40915718 missense probably benign 0.01
X0028:Zfp518a UTSW 19 40914933 missense possibly damaging 0.61
X0065:Zfp518a UTSW 19 40914182 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCCTTACCAGTCTTAGTGC -3'
(R):5'- ACTAGAATCCTTTGGAAGCCTAGG -3'

Sequencing Primer
(F):5'- CATGGTTTGATGCCAGCAAATG -3'
(R):5'- TGGAAGCCTAGGTCTGCTAAATCC -3'
Posted On2016-10-05