Incidental Mutation 'R5510:Trip12'
ID431115
Institutional Source Beutler Lab
Gene Symbol Trip12
Ensembl Gene ENSMUSG00000026219
Gene Namethyroid hormone receptor interactor 12
Synonyms6720416K24Rik, 1110036I07Rik, Gtl6
MMRRC Submission 043071-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5510 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location84721189-84840516 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84768680 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 459 (Q459R)
Ref Sequence ENSEMBL: ENSMUSP00000140267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027421] [ENSMUST00000185909] [ENSMUST00000186465] [ENSMUST00000186648] [ENSMUST00000186894]
Predicted Effect probably damaging
Transcript: ENSMUST00000027421
AA Change: Q459R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027421
Gene: ENSMUSG00000026219
AA Change: Q459R

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 416 427 N/A INTRINSIC
SCOP:d1ee4a_ 446 660 5e-20 SMART
PDB:1WA5|B 447 641 1e-5 PDB
Pfam:WWE 765 831 7.6e-22 PFAM
low complexity region 983 1006 N/A INTRINSIC
low complexity region 1033 1047 N/A INTRINSIC
low complexity region 1062 1073 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 1345 1362 N/A INTRINSIC
Blast:HECTc 1363 1417 8e-8 BLAST
Blast:HECTc 1573 1629 2e-24 BLAST
HECTc 1636 2025 1.29e-177 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185672
Predicted Effect probably benign
Transcript: ENSMUST00000185909
SMART Domains Protein: ENSMUSP00000139986
Gene: ENSMUSG00000026219

DomainStartEndE-ValueType
low complexity region 195 214 N/A INTRINSIC
low complexity region 219 230 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 273 289 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186465
AA Change: Q459R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140224
Gene: ENSMUSG00000026219
AA Change: Q459R

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 416 427 N/A INTRINSIC
SCOP:d1ee4a_ 446 660 5e-20 SMART
PDB:1WA5|B 447 641 1e-5 PDB
Pfam:WWE 761 831 2.2e-22 PFAM
low complexity region 983 1006 N/A INTRINSIC
low complexity region 1033 1047 N/A INTRINSIC
low complexity region 1062 1073 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 1345 1362 N/A INTRINSIC
Blast:HECTc 1363 1417 8e-8 BLAST
Blast:HECTc 1573 1629 2e-24 BLAST
HECTc 1636 2025 1.29e-177 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186648
AA Change: Q453R

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139563
Gene: ENSMUSG00000026219
AA Change: Q453R

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
low complexity region 410 421 N/A INTRINSIC
SCOP:d1ee4a_ 440 654 5e-20 SMART
PDB:1WA5|B 441 635 1e-5 PDB
low complexity region 950 973 N/A INTRINSIC
low complexity region 1000 1014 N/A INTRINSIC
low complexity region 1029 1040 N/A INTRINSIC
low complexity region 1300 1311 N/A INTRINSIC
low complexity region 1312 1329 N/A INTRINSIC
Blast:HECTc 1330 1384 7e-8 BLAST
Blast:HECTc 1540 1596 2e-24 BLAST
HECTc 1603 1992 6.2e-180 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186894
AA Change: Q459R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140267
Gene: ENSMUSG00000026219
AA Change: Q459R

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 416 427 N/A INTRINSIC
SCOP:d1ee4a_ 446 660 3e-20 SMART
PDB:1WA5|B 447 641 7e-6 PDB
Blast:ARM 476 516 6e-6 BLAST
WWE 764 839 6.9e-25 SMART
Predicted Effect unknown
Transcript: ENSMUST00000190464
AA Change: Q139R
Meta Mutation Damage Score 0.2161 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.1%
Validation Efficiency 99% (91/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase involved in the degradation of the p19ARF/ARF isoform of CDKN2A, a tumor suppressor. The encoded protein also plays a role in the DNA damage response by regulating the stability of USP7, which regulates tumor suppressor p53. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted allele exhibit complete embryonic lethality during organogenesis associated with embryonic growth retardation and abnormal placenta development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,538,084 probably null Het
1700014D04Rik T C 13: 59,742,420 probably null Het
Adgrl4 T G 3: 151,497,830 I59R possibly damaging Het
Adgrv1 T A 13: 81,445,244 D4208V probably damaging Het
Aimp2 A T 5: 143,906,529 probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ankib1 A G 5: 3,729,693 V392A probably benign Het
Ap2b1 A G 11: 83,336,737 probably null Het
Arsg A G 11: 109,527,874 E232G probably benign Het
Axdnd1 A G 1: 156,335,350 F144S probably benign Het
Bud13 T A 9: 46,292,200 M111K probably damaging Het
Cav2 T C 6: 17,287,013 F152S possibly damaging Het
Ccdc180 A G 4: 45,928,046 T1194A probably damaging Het
Ccdc88c T C 12: 100,945,031 K848R probably damaging Het
Ceacam15 A G 7: 16,672,099 W176R probably damaging Het
Cenpf A T 1: 189,682,903 D136E probably benign Het
Dclk2 T C 3: 86,906,037 I201V possibly damaging Het
Defa24 T A 8: 21,734,596 D20E probably damaging Het
Dgcr8 T C 16: 18,277,175 N566D probably damaging Het
Dido1 C A 2: 180,685,173 V386L probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dtx3 G A 10: 127,192,938 P141S probably benign Het
Fmn1 T C 2: 113,596,369 Y1144H probably damaging Het
Gabbr2 A G 4: 46,734,113 L535P probably damaging Het
Gimap3 T A 6: 48,765,249 E249V possibly damaging Het
Git2 A T 5: 114,743,774 probably null Het
Gm4922 T C 10: 18,783,997 T326A probably benign Het
Gsdmc2 T G 15: 63,828,196 E242D probably benign Het
Hdgfl2 G A 17: 56,082,118 G31S possibly damaging Het
Herc2 A T 7: 56,206,771 I3956F probably damaging Het
Hsf2bp G A 17: 31,946,747 R134C unknown Het
Igf1r G C 7: 68,193,359 R739S probably benign Het
Igkv4-51 T C 6: 69,681,459 E102G probably damaging Het
Kif1a T G 1: 93,041,692 I1156L possibly damaging Het
Kti12 T C 4: 108,848,624 L245S probably damaging Het
Med17 A G 9: 15,270,404 S17P probably benign Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Mrps18b A G 17: 35,914,323 probably benign Het
Ms4a8a A G 19: 11,079,464 S85P probably benign Het
Msln T C 17: 25,749,873 Q487R probably benign Het
Myh13 A G 11: 67,337,723 N363S probably benign Het
Myo6 T C 9: 80,245,660 F192L probably damaging Het
Nfkbiz T C 16: 55,814,020 D688G probably damaging Het
Nsun4 C T 4: 116,051,777 V529I possibly damaging Het
Olfr105-ps A T 17: 37,383,301 M245L probably benign Het
Olfr345 G A 2: 36,640,963 R308K probably benign Het
Olfr495 G A 7: 108,395,125 A2T probably benign Het
Phf11a C A 14: 59,279,385 C208F probably damaging Het
Plekhh2 G A 17: 84,566,847 C520Y probably benign Het
Plxna4 C A 6: 32,178,358 M1550I probably damaging Het
Pnpla6 A T 8: 3,521,397 Y140F probably damaging Het
Ppp1r12a T A 10: 108,249,627 S478T possibly damaging Het
Prkcz C A 4: 155,272,936 probably null Het
Prss55 T A 14: 64,077,125 M199L probably damaging Het
Qrich1 G A 9: 108,556,460 V651I possibly damaging Het
Ralyl T C 3: 13,776,945 V47A probably damaging Het
Raph1 A T 1: 60,522,946 probably benign Het
Rgs12 T C 5: 34,966,039 Y389H probably damaging Het
Sec24b C A 3: 130,040,895 G82V probably damaging Het
Sema4a A G 3: 88,449,986 probably null Het
Slc25a11 A T 11: 70,645,535 W149R probably damaging Het
Slc2a7 T G 4: 150,160,094 S340A probably benign Het
Slc32a1 T A 2: 158,614,796 M457K probably damaging Het
Spint4 C T 2: 164,700,892 T135M probably damaging Het
Sult2a2 A C 7: 13,738,303 N142H probably damaging Het
Tbc1d1 G A 5: 64,333,395 G863D probably damaging Het
Tmem156 G A 5: 65,075,574 T151M probably benign Het
Vmn2r116 G A 17: 23,386,121 C136Y probably damaging Het
Vmn2r51 C T 7: 10,102,618 V79M possibly damaging Het
Vmn2r67 A T 7: 85,151,815 D304E probably benign Het
Wdr93 T A 7: 79,750,031 F123I probably damaging Het
Zfp672 A T 11: 58,316,630 C288* probably null Het
Zp1 T C 19: 10,919,405 Y90C probably damaging Het
Other mutations in Trip12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Trip12 APN 1 84730541 missense probably damaging 1.00
IGL00430:Trip12 APN 1 84763861 missense probably damaging 0.96
IGL00465:Trip12 APN 1 84763861 missense probably damaging 0.96
IGL00819:Trip12 APN 1 84754272 missense probably damaging 1.00
IGL00900:Trip12 APN 1 84724764 missense possibly damaging 0.56
IGL00990:Trip12 APN 1 84751884 missense probably damaging 0.99
IGL01087:Trip12 APN 1 84757859 missense probably damaging 0.99
IGL01400:Trip12 APN 1 84751978 missense probably damaging 0.99
IGL01521:Trip12 APN 1 84766198 splice site probably benign
IGL01619:Trip12 APN 1 84814910 missense probably damaging 0.99
IGL01796:Trip12 APN 1 84728278 missense probably benign 0.42
IGL01975:Trip12 APN 1 84814813 splice site probably benign
IGL02190:Trip12 APN 1 84766070 missense probably damaging 0.98
IGL02474:Trip12 APN 1 84794133 missense probably benign
IGL02517:Trip12 APN 1 84743814 unclassified probably benign
IGL02631:Trip12 APN 1 84766008 missense possibly damaging 0.91
IGL02991:Trip12 APN 1 84738815 missense probably damaging 1.00
IGL03161:Trip12 APN 1 84761132 unclassified probably benign
IGL03388:Trip12 APN 1 84743186 missense probably damaging 0.99
cardamom UTSW 1 84749276 missense probably damaging 0.99
Turmeric UTSW 1 84754343 missense probably benign 0.07
LCD18:Trip12 UTSW 1 84754482 unclassified probably benign
R0090:Trip12 UTSW 1 84732136 splice site probably benign
R0111:Trip12 UTSW 1 84759133 unclassified probably benign
R0471:Trip12 UTSW 1 84726207 missense probably damaging 1.00
R0486:Trip12 UTSW 1 84761084 nonsense probably null
R0557:Trip12 UTSW 1 84724747 missense probably damaging 1.00
R0570:Trip12 UTSW 1 84751548 missense probably damaging 1.00
R0614:Trip12 UTSW 1 84757761 missense probably damaging 1.00
R0627:Trip12 UTSW 1 84768597 missense probably damaging 1.00
R0630:Trip12 UTSW 1 84793915 missense possibly damaging 0.70
R0657:Trip12 UTSW 1 84759050 missense probably benign 0.19
R0741:Trip12 UTSW 1 84745181 missense probably benign 0.09
R0862:Trip12 UTSW 1 84744009 missense probably damaging 0.99
R0864:Trip12 UTSW 1 84744009 missense probably damaging 0.99
R1124:Trip12 UTSW 1 84737037 missense probably damaging 1.00
R1252:Trip12 UTSW 1 84776350 nonsense probably null
R1455:Trip12 UTSW 1 84759100 missense probably benign 0.01
R1487:Trip12 UTSW 1 84768631 missense probably damaging 1.00
R1702:Trip12 UTSW 1 84745063 missense probably damaging 1.00
R1781:Trip12 UTSW 1 84730621 missense probably benign 0.01
R1847:Trip12 UTSW 1 84749269 missense probably damaging 1.00
R1854:Trip12 UTSW 1 84728145 missense probably damaging 1.00
R1866:Trip12 UTSW 1 84745060 missense probably damaging 1.00
R1926:Trip12 UTSW 1 84749291 missense probably damaging 0.98
R1935:Trip12 UTSW 1 84794101 missense possibly damaging 0.46
R1950:Trip12 UTSW 1 84760801 missense probably damaging 1.00
R1994:Trip12 UTSW 1 84749172 missense probably damaging 1.00
R2014:Trip12 UTSW 1 84760866 nonsense probably null
R2391:Trip12 UTSW 1 84814790 frame shift probably null
R2423:Trip12 UTSW 1 84814790 frame shift probably null
R2433:Trip12 UTSW 1 84743823 missense possibly damaging 0.84
R2905:Trip12 UTSW 1 84754343 missense probably benign 0.07
R3040:Trip12 UTSW 1 84742245 missense probably benign 0.13
R3735:Trip12 UTSW 1 84814790 frame shift probably null
R3907:Trip12 UTSW 1 84732106 missense possibly damaging 0.53
R4394:Trip12 UTSW 1 84725741 missense probably damaging 1.00
R4540:Trip12 UTSW 1 84749276 missense probably damaging 0.99
R4859:Trip12 UTSW 1 84793810 missense probably damaging 0.99
R5240:Trip12 UTSW 1 84794133 missense probably benign
R5278:Trip12 UTSW 1 84762147 missense probably damaging 1.00
R5377:Trip12 UTSW 1 84757431 missense probably damaging 1.00
R5542:Trip12 UTSW 1 84749344 missense probably damaging 1.00
R5550:Trip12 UTSW 1 84761099 missense probably damaging 0.99
R5886:Trip12 UTSW 1 84730458 intron probably benign
R5893:Trip12 UTSW 1 84759163 unclassified probably benign
R5914:Trip12 UTSW 1 84763458 missense probably damaging 1.00
R5925:Trip12 UTSW 1 84749253 nonsense probably null
R5985:Trip12 UTSW 1 84725771 missense probably damaging 0.99
R6135:Trip12 UTSW 1 84760838 missense probably benign 0.00
R6158:Trip12 UTSW 1 84761012 missense possibly damaging 0.84
R6419:Trip12 UTSW 1 84793870 missense probably damaging 1.00
R6816:Trip12 UTSW 1 84793714 missense probably damaging 0.99
R7144:Trip12 UTSW 1 84793714 missense probably damaging 0.99
R7194:Trip12 UTSW 1 84794222 missense probably benign 0.07
R7355:Trip12 UTSW 1 84814883 missense probably damaging 1.00
R7361:Trip12 UTSW 1 84750442 missense probably damaging 0.98
R7588:Trip12 UTSW 1 84760883 missense probably damaging 0.99
R7705:Trip12 UTSW 1 84777449 missense probably damaging 1.00
R7818:Trip12 UTSW 1 84760806 missense probably damaging 1.00
X0023:Trip12 UTSW 1 84760787 missense probably benign 0.12
X0065:Trip12 UTSW 1 84749163 missense probably benign 0.21
Z1088:Trip12 UTSW 1 84766168 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCAAGCTGGGTGTGTAGC -3'
(R):5'- CTCAGAATTCTACTAGCTCATCAGTG -3'

Sequencing Primer
(F):5'- GGTGTGTAGCTCATTGAGAAAG -3'
(R):5'- GTCTGTCTGTGCACACATATGAACAC -3'
Posted On2016-10-05