Incidental Mutation 'R5510:Vmn2r51'
ID 431146
Institutional Source Beutler Lab
Gene Symbol Vmn2r51
Ensembl Gene ENSMUSG00000058685
Gene Name vomeronasal 2, receptor 51
Synonyms
MMRRC Submission 043071-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R5510 (G1)
Quality Score 178
Status Validated
Chromosome 7
Chromosomal Location 9821125-9839586 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 9836545 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 79 (V79M)
Ref Sequence ENSEMBL: ENSMUSP00000092459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094863]
AlphaFold L7N215
Predicted Effect possibly damaging
Transcript: ENSMUST00000094863
AA Change: V79M

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000092459
Gene: ENSMUSG00000058685
AA Change: V79M

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.4e-31 PFAM
Pfam:NCD3G 512 565 8.1e-21 PFAM
Pfam:7tm_3 598 833 2.7e-54 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.1%
Validation Efficiency 99% (91/92)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 T G 3: 151,203,467 (GRCm39) I59R possibly damaging Het
Adgrv1 T A 13: 81,593,363 (GRCm39) D4208V probably damaging Het
Aimp2 A T 5: 143,843,347 (GRCm39) probably benign Het
Ank3 G A 10: 69,838,395 (GRCm39) R1566K possibly damaging Het
Ankib1 A G 5: 3,779,693 (GRCm39) V392A probably benign Het
Ap2b1 A G 11: 83,227,563 (GRCm39) probably null Het
Arsg A G 11: 109,418,700 (GRCm39) E232G probably benign Het
Axdnd1 A G 1: 156,162,920 (GRCm39) F144S probably benign Het
Bud13 T A 9: 46,203,498 (GRCm39) M111K probably damaging Het
Cav2 T C 6: 17,287,012 (GRCm39) F152S possibly damaging Het
Ccdc180 A G 4: 45,928,046 (GRCm39) T1194A probably damaging Het
Ccdc192 G A 18: 57,671,156 (GRCm39) probably null Het
Ccdc88c T C 12: 100,911,290 (GRCm39) K848R probably damaging Het
Ceacam15 A G 7: 16,406,024 (GRCm39) W176R probably damaging Het
Cenpf A T 1: 189,415,100 (GRCm39) D136E probably benign Het
Dclk2 T C 3: 86,813,344 (GRCm39) I201V possibly damaging Het
Defa24 T A 8: 22,224,612 (GRCm39) D20E probably damaging Het
Dgcr8 T C 16: 18,095,039 (GRCm39) N566D probably damaging Het
Dido1 C A 2: 180,326,966 (GRCm39) V386L probably benign Het
Dnah2 C T 11: 69,349,746 (GRCm39) R2399Q probably benign Het
Dtx3 G A 10: 127,028,807 (GRCm39) P141S probably benign Het
Fmn1 T C 2: 113,426,714 (GRCm39) Y1144H probably damaging Het
Gabbr2 A G 4: 46,734,113 (GRCm39) L535P probably damaging Het
Gimap3 T A 6: 48,742,183 (GRCm39) E249V possibly damaging Het
Git2 A T 5: 114,881,835 (GRCm39) probably null Het
Gm4922 T C 10: 18,659,745 (GRCm39) T326A probably benign Het
Gsdmc2 T G 15: 63,700,045 (GRCm39) E242D probably benign Het
Hdgfl2 G A 17: 56,389,118 (GRCm39) G31S possibly damaging Het
Herc2 A T 7: 55,856,519 (GRCm39) I3956F probably damaging Het
Hsf2bp G A 17: 32,165,721 (GRCm39) R134C unknown Het
Igf1r G C 7: 67,843,107 (GRCm39) R739S probably benign Het
Igkv4-51 T C 6: 69,658,443 (GRCm39) E102G probably damaging Het
Kif1a T G 1: 92,969,414 (GRCm39) I1156L possibly damaging Het
Kti12 T C 4: 108,705,821 (GRCm39) L245S probably damaging Het
Med17 A G 9: 15,181,700 (GRCm39) S17P probably benign Het
Mllt6 G A 11: 97,560,326 (GRCm39) S210N possibly damaging Het
Mrps18b A G 17: 36,225,215 (GRCm39) probably benign Het
Ms4a8a A G 19: 11,056,828 (GRCm39) S85P probably benign Het
Msln T C 17: 25,968,847 (GRCm39) Q487R probably benign Het
Myh13 A G 11: 67,228,549 (GRCm39) N363S probably benign Het
Myo6 T C 9: 80,152,942 (GRCm39) F192L probably damaging Het
Nfkbiz T C 16: 55,634,383 (GRCm39) D688G probably damaging Het
Nsun4 C T 4: 115,908,974 (GRCm39) V529I possibly damaging Het
Or12d15 A T 17: 37,694,192 (GRCm39) M245L probably benign Het
Or1j16 G A 2: 36,530,975 (GRCm39) R308K probably benign Het
Or5p70 G A 7: 107,994,332 (GRCm39) A2T probably benign Het
Phf11a C A 14: 59,516,834 (GRCm39) C208F probably damaging Het
Plekhh2 G A 17: 84,874,275 (GRCm39) C520Y probably benign Het
Plxna4 C A 6: 32,155,293 (GRCm39) M1550I probably damaging Het
Pnpla6 A T 8: 3,571,397 (GRCm39) Y140F probably damaging Het
Ppp1r12a T A 10: 108,085,488 (GRCm39) S478T possibly damaging Het
Prkcz C A 4: 155,357,393 (GRCm39) probably null Het
Prss55 T A 14: 64,314,574 (GRCm39) M199L probably damaging Het
Qrich1 G A 9: 108,433,659 (GRCm39) V651I possibly damaging Het
Ralyl T C 3: 13,842,005 (GRCm39) V47A probably damaging Het
Raph1 A T 1: 60,562,105 (GRCm39) probably benign Het
Rgs12 T C 5: 35,123,383 (GRCm39) Y389H probably damaging Het
Sec24b C A 3: 129,834,544 (GRCm39) G82V probably damaging Het
Sema4a A G 3: 88,357,293 (GRCm39) probably null Het
Slc25a11 A T 11: 70,536,361 (GRCm39) W149R probably damaging Het
Slc2a7 T G 4: 150,244,551 (GRCm39) S340A probably benign Het
Slc32a1 T A 2: 158,456,716 (GRCm39) M457K probably damaging Het
Spata31d1e T C 13: 59,890,234 (GRCm39) probably null Het
Spint4 C T 2: 164,542,812 (GRCm39) T135M probably damaging Het
Sult2a2 A C 7: 13,472,228 (GRCm39) N142H probably damaging Het
Tbc1d1 G A 5: 64,490,738 (GRCm39) G863D probably damaging Het
Tmem156 G A 5: 65,232,917 (GRCm39) T151M probably benign Het
Trip12 T C 1: 84,746,401 (GRCm39) Q459R probably damaging Het
Vmn2r116 G A 17: 23,605,095 (GRCm39) C136Y probably damaging Het
Vmn2r67 A T 7: 84,801,023 (GRCm39) D304E probably benign Het
Wdr93 T A 7: 79,399,779 (GRCm39) F123I probably damaging Het
Zfp672 A T 11: 58,207,456 (GRCm39) C288* probably null Het
Zp1 T C 19: 10,896,769 (GRCm39) Y90C probably damaging Het
Other mutations in Vmn2r51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01398:Vmn2r51 APN 7 9,836,341 (GRCm39) missense probably benign
IGL01574:Vmn2r51 APN 7 9,836,381 (GRCm39) missense probably damaging 1.00
IGL01743:Vmn2r51 APN 7 9,834,154 (GRCm39) missense probably damaging 0.98
IGL01820:Vmn2r51 APN 7 9,839,409 (GRCm39) missense probably damaging 1.00
IGL02563:Vmn2r51 APN 7 9,834,243 (GRCm39) missense probably benign 0.00
IGL02825:Vmn2r51 APN 7 9,832,046 (GRCm39) splice site probably benign
IGL02834:Vmn2r51 APN 7 9,832,063 (GRCm39) nonsense probably null
R0617:Vmn2r51 UTSW 7 9,834,396 (GRCm39) missense possibly damaging 0.65
R0967:Vmn2r51 UTSW 7 9,834,012 (GRCm39) missense probably damaging 0.97
R1465:Vmn2r51 UTSW 7 9,834,249 (GRCm39) missense probably damaging 1.00
R1465:Vmn2r51 UTSW 7 9,834,249 (GRCm39) missense probably damaging 1.00
R1559:Vmn2r51 UTSW 7 9,836,373 (GRCm39) missense possibly damaging 0.87
R1559:Vmn2r51 UTSW 7 9,836,372 (GRCm39) missense possibly damaging 0.58
R1598:Vmn2r51 UTSW 7 9,839,432 (GRCm39) missense probably benign
R1754:Vmn2r51 UTSW 7 9,833,873 (GRCm39) missense probably benign 0.04
R1836:Vmn2r51 UTSW 7 9,832,091 (GRCm39) nonsense probably null
R1836:Vmn2r51 UTSW 7 9,832,090 (GRCm39) nonsense probably null
R3151:Vmn2r51 UTSW 7 9,833,968 (GRCm39) missense probably damaging 1.00
R4566:Vmn2r51 UTSW 7 9,836,341 (GRCm39) missense probably benign
R4933:Vmn2r51 UTSW 7 9,832,247 (GRCm39) missense probably damaging 1.00
R5004:Vmn2r51 UTSW 7 9,821,932 (GRCm39) missense probably benign
R5050:Vmn2r51 UTSW 7 9,834,349 (GRCm39) missense probably damaging 0.99
R5559:Vmn2r51 UTSW 7 9,826,128 (GRCm39) missense probably damaging 1.00
R6127:Vmn2r51 UTSW 7 9,839,558 (GRCm39) missense probably damaging 1.00
R6154:Vmn2r51 UTSW 7 9,821,921 (GRCm39) missense possibly damaging 0.74
R6304:Vmn2r51 UTSW 7 9,832,164 (GRCm39) missense probably benign 0.00
R6370:Vmn2r51 UTSW 7 9,832,143 (GRCm39) missense probably damaging 1.00
R6471:Vmn2r51 UTSW 7 9,836,510 (GRCm39) missense possibly damaging 0.48
R6800:Vmn2r51 UTSW 7 9,832,191 (GRCm39) missense probably damaging 0.99
R6883:Vmn2r51 UTSW 7 9,834,025 (GRCm39) missense possibly damaging 0.75
R7191:Vmn2r51 UTSW 7 9,834,480 (GRCm39) missense probably null 1.00
R7246:Vmn2r51 UTSW 7 9,836,428 (GRCm39) missense probably benign 0.00
R8939:Vmn2r51 UTSW 7 9,833,953 (GRCm39) missense possibly damaging 0.85
R9154:Vmn2r51 UTSW 7 9,839,480 (GRCm39) missense probably damaging 0.96
R9428:Vmn2r51 UTSW 7 9,833,712 (GRCm39) critical splice donor site probably benign
R9451:Vmn2r51 UTSW 7 9,833,816 (GRCm39) missense probably damaging 1.00
R9729:Vmn2r51 UTSW 7 9,839,479 (GRCm39) missense probably benign 0.00
R9767:Vmn2r51 UTSW 7 9,839,407 (GRCm39) missense probably benign 0.09
Z1176:Vmn2r51 UTSW 7 9,833,835 (GRCm39) missense probably benign 0.12
Z1176:Vmn2r51 UTSW 7 9,821,984 (GRCm39) missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- ACCTCCCAATTGGATTCTGAAAG -3'
(R):5'- TCAGGTCCATCTGTCAATCCAATC -3'

Sequencing Primer
(F):5'- GCAGAAAGGAACACATAGTCTCTTC -3'
(R):5'- TCCATCTGTCAATCCAATCTTATAAC -3'
Posted On 2016-10-05