Incidental Mutation 'R5510:Igf1r'
ID 431151
Institutional Source Beutler Lab
Gene Symbol Igf1r
Ensembl Gene ENSMUSG00000005533
Gene Name insulin-like growth factor I receptor
Synonyms IGF-1R, line 186, A330103N21Rik, hyft, CD221
MMRRC Submission 043071-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5510 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 67602575-67883416 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 67843107 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 739 (R739S)
Ref Sequence ENSEMBL: ENSMUSP00000005671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005671]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000005671
AA Change: R739S

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000005671
Gene: ENSMUSG00000005533
AA Change: R739S

DomainStartEndE-ValueType
Pfam:Recep_L_domain 51 161 1.6e-29 PFAM
FU 227 270 2.98e-12 SMART
Pfam:Recep_L_domain 353 467 3.8e-32 PFAM
FN3 490 593 4.67e-2 SMART
FN3 612 815 1.95e-4 SMART
FN3 833 915 7.4e-5 SMART
low complexity region 937 954 N/A INTRINSIC
TyrKc 1000 1268 8.51e-141 SMART
low complexity region 1285 1303 N/A INTRINSIC
low complexity region 1306 1319 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208348
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.1%
Validation Efficiency 99% (91/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This receptor binds insulin-like growth factor with a high affinity. It has tyrosine kinase activity. The insulin-like growth factor I receptor plays a critical role in transformation events. Cleavage of the precursor generates alpha and beta subunits. It is highly overexpressed in most malignant tissues where it functions as an anti-apoptotic agent by enhancing cell survival. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Targeted null mutants die at birth of respiratory failure; fetuses exhibit retarded growth, organ hypoplasia, ossification delay and nervous system and epidermal abnormalities. hyft homozygous fetuses are growth retarded and exhibit hydrops fetalis and focal hepatic ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 T G 3: 151,203,467 (GRCm39) I59R possibly damaging Het
Adgrv1 T A 13: 81,593,363 (GRCm39) D4208V probably damaging Het
Aimp2 A T 5: 143,843,347 (GRCm39) probably benign Het
Ank3 G A 10: 69,838,395 (GRCm39) R1566K possibly damaging Het
Ankib1 A G 5: 3,779,693 (GRCm39) V392A probably benign Het
Ap2b1 A G 11: 83,227,563 (GRCm39) probably null Het
Arsg A G 11: 109,418,700 (GRCm39) E232G probably benign Het
Axdnd1 A G 1: 156,162,920 (GRCm39) F144S probably benign Het
Bud13 T A 9: 46,203,498 (GRCm39) M111K probably damaging Het
Cav2 T C 6: 17,287,012 (GRCm39) F152S possibly damaging Het
Ccdc180 A G 4: 45,928,046 (GRCm39) T1194A probably damaging Het
Ccdc192 G A 18: 57,671,156 (GRCm39) probably null Het
Ccdc88c T C 12: 100,911,290 (GRCm39) K848R probably damaging Het
Ceacam15 A G 7: 16,406,024 (GRCm39) W176R probably damaging Het
Cenpf A T 1: 189,415,100 (GRCm39) D136E probably benign Het
Dclk2 T C 3: 86,813,344 (GRCm39) I201V possibly damaging Het
Defa24 T A 8: 22,224,612 (GRCm39) D20E probably damaging Het
Dgcr8 T C 16: 18,095,039 (GRCm39) N566D probably damaging Het
Dido1 C A 2: 180,326,966 (GRCm39) V386L probably benign Het
Dnah2 C T 11: 69,349,746 (GRCm39) R2399Q probably benign Het
Dtx3 G A 10: 127,028,807 (GRCm39) P141S probably benign Het
Fmn1 T C 2: 113,426,714 (GRCm39) Y1144H probably damaging Het
Gabbr2 A G 4: 46,734,113 (GRCm39) L535P probably damaging Het
Gimap3 T A 6: 48,742,183 (GRCm39) E249V possibly damaging Het
Git2 A T 5: 114,881,835 (GRCm39) probably null Het
Gm4922 T C 10: 18,659,745 (GRCm39) T326A probably benign Het
Gsdmc2 T G 15: 63,700,045 (GRCm39) E242D probably benign Het
Hdgfl2 G A 17: 56,389,118 (GRCm39) G31S possibly damaging Het
Herc2 A T 7: 55,856,519 (GRCm39) I3956F probably damaging Het
Hsf2bp G A 17: 32,165,721 (GRCm39) R134C unknown Het
Igkv4-51 T C 6: 69,658,443 (GRCm39) E102G probably damaging Het
Kif1a T G 1: 92,969,414 (GRCm39) I1156L possibly damaging Het
Kti12 T C 4: 108,705,821 (GRCm39) L245S probably damaging Het
Med17 A G 9: 15,181,700 (GRCm39) S17P probably benign Het
Mllt6 G A 11: 97,560,326 (GRCm39) S210N possibly damaging Het
Mrps18b A G 17: 36,225,215 (GRCm39) probably benign Het
Ms4a8a A G 19: 11,056,828 (GRCm39) S85P probably benign Het
Msln T C 17: 25,968,847 (GRCm39) Q487R probably benign Het
Myh13 A G 11: 67,228,549 (GRCm39) N363S probably benign Het
Myo6 T C 9: 80,152,942 (GRCm39) F192L probably damaging Het
Nfkbiz T C 16: 55,634,383 (GRCm39) D688G probably damaging Het
Nsun4 C T 4: 115,908,974 (GRCm39) V529I possibly damaging Het
Or12d15 A T 17: 37,694,192 (GRCm39) M245L probably benign Het
Or1j16 G A 2: 36,530,975 (GRCm39) R308K probably benign Het
Or5p70 G A 7: 107,994,332 (GRCm39) A2T probably benign Het
Phf11a C A 14: 59,516,834 (GRCm39) C208F probably damaging Het
Plekhh2 G A 17: 84,874,275 (GRCm39) C520Y probably benign Het
Plxna4 C A 6: 32,155,293 (GRCm39) M1550I probably damaging Het
Pnpla6 A T 8: 3,571,397 (GRCm39) Y140F probably damaging Het
Ppp1r12a T A 10: 108,085,488 (GRCm39) S478T possibly damaging Het
Prkcz C A 4: 155,357,393 (GRCm39) probably null Het
Prss55 T A 14: 64,314,574 (GRCm39) M199L probably damaging Het
Qrich1 G A 9: 108,433,659 (GRCm39) V651I possibly damaging Het
Ralyl T C 3: 13,842,005 (GRCm39) V47A probably damaging Het
Raph1 A T 1: 60,562,105 (GRCm39) probably benign Het
Rgs12 T C 5: 35,123,383 (GRCm39) Y389H probably damaging Het
Sec24b C A 3: 129,834,544 (GRCm39) G82V probably damaging Het
Sema4a A G 3: 88,357,293 (GRCm39) probably null Het
Slc25a11 A T 11: 70,536,361 (GRCm39) W149R probably damaging Het
Slc2a7 T G 4: 150,244,551 (GRCm39) S340A probably benign Het
Slc32a1 T A 2: 158,456,716 (GRCm39) M457K probably damaging Het
Spata31d1e T C 13: 59,890,234 (GRCm39) probably null Het
Spint4 C T 2: 164,542,812 (GRCm39) T135M probably damaging Het
Sult2a2 A C 7: 13,472,228 (GRCm39) N142H probably damaging Het
Tbc1d1 G A 5: 64,490,738 (GRCm39) G863D probably damaging Het
Tmem156 G A 5: 65,232,917 (GRCm39) T151M probably benign Het
Trip12 T C 1: 84,746,401 (GRCm39) Q459R probably damaging Het
Vmn2r116 G A 17: 23,605,095 (GRCm39) C136Y probably damaging Het
Vmn2r51 C T 7: 9,836,545 (GRCm39) V79M possibly damaging Het
Vmn2r67 A T 7: 84,801,023 (GRCm39) D304E probably benign Het
Wdr93 T A 7: 79,399,779 (GRCm39) F123I probably damaging Het
Zfp672 A T 11: 58,207,456 (GRCm39) C288* probably null Het
Zp1 T C 19: 10,896,769 (GRCm39) Y90C probably damaging Het
Other mutations in Igf1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Igf1r APN 7 67,839,771 (GRCm39) missense probably benign
IGL00837:Igf1r APN 7 67,851,100 (GRCm39) splice site probably benign
IGL01515:Igf1r APN 7 67,857,200 (GRCm39) missense probably damaging 1.00
IGL01572:Igf1r APN 7 67,843,189 (GRCm39) missense probably benign 0.01
IGL02100:Igf1r APN 7 67,839,706 (GRCm39) missense probably benign 0.05
IGL02506:Igf1r APN 7 67,843,144 (GRCm39) missense probably benign
IGL02672:Igf1r APN 7 67,839,781 (GRCm39) missense probably benign 0.05
IGL02701:Igf1r APN 7 67,850,997 (GRCm39) missense possibly damaging 0.93
IGL02742:Igf1r APN 7 67,839,739 (GRCm39) missense possibly damaging 0.94
IGL03073:Igf1r APN 7 67,864,791 (GRCm39) missense probably damaging 1.00
IGL03257:Igf1r APN 7 67,864,688 (GRCm39) missense probably damaging 1.00
Frufru UTSW 7 67,653,911 (GRCm39) missense probably damaging 1.00
Hungarian UTSW 7 67,864,745 (GRCm39) missense probably damaging 1.00
Mimi UTSW 7 67,844,774 (GRCm39) missense possibly damaging 0.67
Piroshka UTSW 7 67,857,084 (GRCm39) nonsense probably null
Romanian UTSW 7 67,653,885 (GRCm39) missense possibly damaging 0.94
Sublime UTSW 7 67,653,927 (GRCm39) missense probably damaging 1.00
Toy UTSW 7 67,653,720 (GRCm39) missense probably damaging 1.00
BB009:Igf1r UTSW 7 67,861,802 (GRCm39) missense possibly damaging 0.88
BB019:Igf1r UTSW 7 67,861,802 (GRCm39) missense possibly damaging 0.88
FR4548:Igf1r UTSW 7 67,875,934 (GRCm39) small insertion probably benign
FR4737:Igf1r UTSW 7 67,875,929 (GRCm39) small insertion probably benign
FR4976:Igf1r UTSW 7 67,875,934 (GRCm39) small insertion probably benign
FR4976:Igf1r UTSW 7 67,875,929 (GRCm39) small insertion probably benign
PIT4445001:Igf1r UTSW 7 67,857,211 (GRCm39) missense probably damaging 1.00
R0003:Igf1r UTSW 7 67,814,990 (GRCm39) missense probably damaging 1.00
R0184:Igf1r UTSW 7 67,875,941 (GRCm39) missense possibly damaging 0.84
R0538:Igf1r UTSW 7 67,857,574 (GRCm39) missense probably damaging 1.00
R0632:Igf1r UTSW 7 67,814,903 (GRCm39) missense probably damaging 1.00
R0727:Igf1r UTSW 7 67,861,906 (GRCm39) critical splice donor site probably null
R0750:Igf1r UTSW 7 67,861,839 (GRCm39) missense probably damaging 0.99
R1104:Igf1r UTSW 7 67,844,774 (GRCm39) missense possibly damaging 0.67
R1169:Igf1r UTSW 7 67,814,875 (GRCm39) missense probably benign 0.00
R1348:Igf1r UTSW 7 67,868,216 (GRCm39) missense probably damaging 1.00
R1471:Igf1r UTSW 7 67,653,585 (GRCm39) missense probably damaging 0.98
R1580:Igf1r UTSW 7 67,857,617 (GRCm39) missense probably benign
R1745:Igf1r UTSW 7 67,819,661 (GRCm39) missense probably damaging 1.00
R1772:Igf1r UTSW 7 67,844,822 (GRCm39) missense probably benign 0.03
R1789:Igf1r UTSW 7 67,864,681 (GRCm39) nonsense probably null
R1823:Igf1r UTSW 7 67,844,729 (GRCm39) missense possibly damaging 0.77
R1902:Igf1r UTSW 7 67,850,997 (GRCm39) missense possibly damaging 0.93
R1962:Igf1r UTSW 7 67,857,023 (GRCm39) missense probably damaging 0.99
R2179:Igf1r UTSW 7 67,653,698 (GRCm39) missense probably damaging 0.99
R2215:Igf1r UTSW 7 67,814,982 (GRCm39) missense probably benign
R2221:Igf1r UTSW 7 67,851,710 (GRCm39) missense probably damaging 1.00
R2233:Igf1r UTSW 7 67,861,828 (GRCm39) missense probably damaging 1.00
R2234:Igf1r UTSW 7 67,861,828 (GRCm39) missense probably damaging 1.00
R2235:Igf1r UTSW 7 67,861,828 (GRCm39) missense probably damaging 1.00
R3023:Igf1r UTSW 7 67,833,147 (GRCm39) missense probably benign 0.00
R4044:Igf1r UTSW 7 67,839,810 (GRCm39) missense possibly damaging 0.83
R4226:Igf1r UTSW 7 67,844,826 (GRCm39) nonsense probably null
R4387:Igf1r UTSW 7 67,819,757 (GRCm39) missense probably benign
R4388:Igf1r UTSW 7 67,819,757 (GRCm39) missense probably benign
R4728:Igf1r UTSW 7 67,839,372 (GRCm39) missense probably damaging 1.00
R4781:Igf1r UTSW 7 67,814,947 (GRCm39) missense possibly damaging 0.75
R5254:Igf1r UTSW 7 67,857,067 (GRCm39) missense probably damaging 0.99
R5278:Igf1r UTSW 7 67,843,166 (GRCm39) missense possibly damaging 0.78
R5522:Igf1r UTSW 7 67,833,258 (GRCm39) missense probably damaging 0.96
R5527:Igf1r UTSW 7 67,857,569 (GRCm39) missense probably damaging 1.00
R5761:Igf1r UTSW 7 67,857,001 (GRCm39) missense probably damaging 1.00
R5849:Igf1r UTSW 7 67,839,781 (GRCm39) missense probably benign
R6189:Igf1r UTSW 7 67,857,084 (GRCm39) nonsense probably null
R6262:Igf1r UTSW 7 67,653,720 (GRCm39) missense probably damaging 1.00
R6285:Igf1r UTSW 7 67,653,885 (GRCm39) missense possibly damaging 0.94
R6318:Igf1r UTSW 7 67,814,981 (GRCm39) missense probably benign 0.02
R6365:Igf1r UTSW 7 67,839,798 (GRCm39) missense probably benign 0.26
R6377:Igf1r UTSW 7 67,850,998 (GRCm39) missense probably benign 0.00
R6831:Igf1r UTSW 7 67,857,067 (GRCm39) missense possibly damaging 0.75
R6848:Igf1r UTSW 7 67,653,927 (GRCm39) missense probably damaging 1.00
R6902:Igf1r UTSW 7 67,653,911 (GRCm39) missense probably damaging 1.00
R7193:Igf1r UTSW 7 67,836,905 (GRCm39) missense probably damaging 1.00
R7373:Igf1r UTSW 7 67,844,826 (GRCm39) nonsense probably null
R7442:Igf1r UTSW 7 67,823,026 (GRCm39) missense probably damaging 1.00
R7903:Igf1r UTSW 7 67,834,500 (GRCm39) missense probably damaging 1.00
R7923:Igf1r UTSW 7 67,839,849 (GRCm39) missense probably damaging 1.00
R7932:Igf1r UTSW 7 67,861,802 (GRCm39) missense possibly damaging 0.88
R8368:Igf1r UTSW 7 67,836,796 (GRCm39) missense probably benign 0.03
R8458:Igf1r UTSW 7 67,845,377 (GRCm39) missense probably benign
R8539:Igf1r UTSW 7 67,653,596 (GRCm39) missense probably benign 0.06
R8704:Igf1r UTSW 7 67,819,802 (GRCm39) splice site probably benign
R8746:Igf1r UTSW 7 67,864,745 (GRCm39) missense probably damaging 1.00
R8829:Igf1r UTSW 7 67,875,769 (GRCm39) missense probably damaging 1.00
R8832:Igf1r UTSW 7 67,875,769 (GRCm39) missense probably damaging 1.00
R8859:Igf1r UTSW 7 67,833,211 (GRCm39) missense possibly damaging 0.75
R9057:Igf1r UTSW 7 67,833,186 (GRCm39) missense probably damaging 1.00
R9243:Igf1r UTSW 7 67,861,775 (GRCm39) missense probably benign 0.11
R9342:Igf1r UTSW 7 67,844,746 (GRCm39) missense probably benign 0.00
R9412:Igf1r UTSW 7 67,857,001 (GRCm39) missense probably damaging 1.00
R9525:Igf1r UTSW 7 67,864,682 (GRCm39) missense probably damaging 1.00
R9727:Igf1r UTSW 7 67,857,554 (GRCm39) missense probably damaging 1.00
R9730:Igf1r UTSW 7 67,839,423 (GRCm39) missense probably damaging 1.00
R9779:Igf1r UTSW 7 67,654,065 (GRCm39) missense probably damaging 1.00
RF025:Igf1r UTSW 7 67,875,927 (GRCm39) small insertion probably benign
RF032:Igf1r UTSW 7 67,875,927 (GRCm39) small insertion probably benign
RF034:Igf1r UTSW 7 67,875,924 (GRCm39) small insertion probably benign
RF037:Igf1r UTSW 7 67,875,924 (GRCm39) small insertion probably benign
RF039:Igf1r UTSW 7 67,875,924 (GRCm39) small insertion probably benign
RF044:Igf1r UTSW 7 67,875,927 (GRCm39) small insertion probably benign
Z1186:Igf1r UTSW 7 67,875,916 (GRCm39) small insertion probably benign
Z1186:Igf1r UTSW 7 67,875,930 (GRCm39) small insertion probably benign
Z1186:Igf1r UTSW 7 67,875,928 (GRCm39) small insertion probably benign
Z1186:Igf1r UTSW 7 67,875,922 (GRCm39) small insertion probably benign
Z1186:Igf1r UTSW 7 67,875,917 (GRCm39) small insertion probably benign
Z1191:Igf1r UTSW 7 67,875,918 (GRCm39) small insertion probably benign
Z1191:Igf1r UTSW 7 67,875,917 (GRCm39) small insertion probably benign
Z1191:Igf1r UTSW 7 67,875,921 (GRCm39) small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TGCACATGTTTCTCTGAGGATG -3'
(R):5'- GCAGCTGTGGATATCGATGC -3'

Sequencing Primer
(F):5'- TCTCAAGAGAGTACAGGATGGGTTG -3'
(R):5'- CTGTGGATATCGATGCGGTACAGAG -3'
Posted On 2016-10-05