Incidental Mutation 'R5510:Igf1r'
ID 431151
Institutional Source Beutler Lab
Gene Symbol Igf1r
Ensembl Gene ENSMUSG00000005533
Gene Name insulin-like growth factor I receptor
Synonyms line 186, A330103N21Rik, CD221, hyft, IGF-1R
MMRRC Submission 043071-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5510 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 67952827-68233668 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 68193359 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 739 (R739S)
Ref Sequence ENSEMBL: ENSMUSP00000005671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005671]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000005671
AA Change: R739S

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000005671
Gene: ENSMUSG00000005533
AA Change: R739S

DomainStartEndE-ValueType
Pfam:Recep_L_domain 51 161 1.6e-29 PFAM
FU 227 270 2.98e-12 SMART
Pfam:Recep_L_domain 353 467 3.8e-32 PFAM
FN3 490 593 4.67e-2 SMART
FN3 612 815 1.95e-4 SMART
FN3 833 915 7.4e-5 SMART
low complexity region 937 954 N/A INTRINSIC
TyrKc 1000 1268 8.51e-141 SMART
low complexity region 1285 1303 N/A INTRINSIC
low complexity region 1306 1319 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208348
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.1%
Validation Efficiency 99% (91/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This receptor binds insulin-like growth factor with a high affinity. It has tyrosine kinase activity. The insulin-like growth factor I receptor plays a critical role in transformation events. Cleavage of the precursor generates alpha and beta subunits. It is highly overexpressed in most malignant tissues where it functions as an anti-apoptotic agent by enhancing cell survival. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Targeted null mutants die at birth of respiratory failure; fetuses exhibit retarded growth, organ hypoplasia, ossification delay and nervous system and epidermal abnormalities. hyft homozygous fetuses are growth retarded and exhibit hydrops fetalis and focal hepatic ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,538,084 probably null Het
1700014D04Rik T C 13: 59,742,420 probably null Het
Adgrl4 T G 3: 151,497,830 I59R possibly damaging Het
Adgrv1 T A 13: 81,445,244 D4208V probably damaging Het
Aimp2 A T 5: 143,906,529 probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ankib1 A G 5: 3,729,693 V392A probably benign Het
Ap2b1 A G 11: 83,336,737 probably null Het
Arsg A G 11: 109,527,874 E232G probably benign Het
Axdnd1 A G 1: 156,335,350 F144S probably benign Het
Bud13 T A 9: 46,292,200 M111K probably damaging Het
Cav2 T C 6: 17,287,013 F152S possibly damaging Het
Ccdc180 A G 4: 45,928,046 T1194A probably damaging Het
Ccdc88c T C 12: 100,945,031 K848R probably damaging Het
Ceacam15 A G 7: 16,672,099 W176R probably damaging Het
Cenpf A T 1: 189,682,903 D136E probably benign Het
Dclk2 T C 3: 86,906,037 I201V possibly damaging Het
Defa24 T A 8: 21,734,596 D20E probably damaging Het
Dgcr8 T C 16: 18,277,175 N566D probably damaging Het
Dido1 C A 2: 180,685,173 V386L probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dtx3 G A 10: 127,192,938 P141S probably benign Het
Fmn1 T C 2: 113,596,369 Y1144H probably damaging Het
Gabbr2 A G 4: 46,734,113 L535P probably damaging Het
Gimap3 T A 6: 48,765,249 E249V possibly damaging Het
Git2 A T 5: 114,743,774 probably null Het
Gm4922 T C 10: 18,783,997 T326A probably benign Het
Gsdmc2 T G 15: 63,828,196 E242D probably benign Het
Hdgfl2 G A 17: 56,082,118 G31S possibly damaging Het
Herc2 A T 7: 56,206,771 I3956F probably damaging Het
Hsf2bp G A 17: 31,946,747 R134C unknown Het
Igkv4-51 T C 6: 69,681,459 E102G probably damaging Het
Kif1a T G 1: 93,041,692 I1156L possibly damaging Het
Kti12 T C 4: 108,848,624 L245S probably damaging Het
Med17 A G 9: 15,270,404 S17P probably benign Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Mrps18b A G 17: 35,914,323 probably benign Het
Ms4a8a A G 19: 11,079,464 S85P probably benign Het
Msln T C 17: 25,749,873 Q487R probably benign Het
Myh13 A G 11: 67,337,723 N363S probably benign Het
Myo6 T C 9: 80,245,660 F192L probably damaging Het
Nfkbiz T C 16: 55,814,020 D688G probably damaging Het
Nsun4 C T 4: 116,051,777 V529I possibly damaging Het
Olfr105-ps A T 17: 37,383,301 M245L probably benign Het
Olfr345 G A 2: 36,640,963 R308K probably benign Het
Olfr495 G A 7: 108,395,125 A2T probably benign Het
Phf11a C A 14: 59,279,385 C208F probably damaging Het
Plekhh2 G A 17: 84,566,847 C520Y probably benign Het
Plxna4 C A 6: 32,178,358 M1550I probably damaging Het
Pnpla6 A T 8: 3,521,397 Y140F probably damaging Het
Ppp1r12a T A 10: 108,249,627 S478T possibly damaging Het
Prkcz C A 4: 155,272,936 probably null Het
Prss55 T A 14: 64,077,125 M199L probably damaging Het
Qrich1 G A 9: 108,556,460 V651I possibly damaging Het
Ralyl T C 3: 13,776,945 V47A probably damaging Het
Raph1 A T 1: 60,522,946 probably benign Het
Rgs12 T C 5: 34,966,039 Y389H probably damaging Het
Sec24b C A 3: 130,040,895 G82V probably damaging Het
Sema4a A G 3: 88,449,986 probably null Het
Slc25a11 A T 11: 70,645,535 W149R probably damaging Het
Slc2a7 T G 4: 150,160,094 S340A probably benign Het
Slc32a1 T A 2: 158,614,796 M457K probably damaging Het
Spint4 C T 2: 164,700,892 T135M probably damaging Het
Sult2a2 A C 7: 13,738,303 N142H probably damaging Het
Tbc1d1 G A 5: 64,333,395 G863D probably damaging Het
Tmem156 G A 5: 65,075,574 T151M probably benign Het
Trip12 T C 1: 84,768,680 Q459R probably damaging Het
Vmn2r116 G A 17: 23,386,121 C136Y probably damaging Het
Vmn2r51 C T 7: 10,102,618 V79M possibly damaging Het
Vmn2r67 A T 7: 85,151,815 D304E probably benign Het
Wdr93 T A 7: 79,750,031 F123I probably damaging Het
Zfp672 A T 11: 58,316,630 C288* probably null Het
Zp1 T C 19: 10,919,405 Y90C probably damaging Het
Other mutations in Igf1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Igf1r APN 7 68190023 missense probably benign
IGL00837:Igf1r APN 7 68201352 splice site probably benign
IGL01515:Igf1r APN 7 68207452 missense probably damaging 1.00
IGL01572:Igf1r APN 7 68193441 missense probably benign 0.01
IGL02100:Igf1r APN 7 68189958 missense probably benign 0.05
IGL02506:Igf1r APN 7 68193396 missense probably benign
IGL02672:Igf1r APN 7 68190033 missense probably benign 0.05
IGL02701:Igf1r APN 7 68201249 missense possibly damaging 0.93
IGL02742:Igf1r APN 7 68189991 missense possibly damaging 0.94
IGL03073:Igf1r APN 7 68215043 missense probably damaging 1.00
IGL03257:Igf1r APN 7 68214940 missense probably damaging 1.00
Frufru UTSW 7 68004163 missense probably damaging 1.00
Hungarian UTSW 7 68214997 missense probably damaging 1.00
Mimi UTSW 7 68195026 missense possibly damaging 0.67
Piroshka UTSW 7 68207336 nonsense probably null
Romanian UTSW 7 68004137 missense possibly damaging 0.94
Sublime UTSW 7 68004179 missense probably damaging 1.00
Toy UTSW 7 68003972 missense probably damaging 1.00
BB009:Igf1r UTSW 7 68212054 missense possibly damaging 0.88
BB019:Igf1r UTSW 7 68212054 missense possibly damaging 0.88
FR4548:Igf1r UTSW 7 68226186 small insertion probably benign
FR4737:Igf1r UTSW 7 68226181 small insertion probably benign
FR4976:Igf1r UTSW 7 68226181 small insertion probably benign
FR4976:Igf1r UTSW 7 68226186 small insertion probably benign
PIT4445001:Igf1r UTSW 7 68207463 missense probably damaging 1.00
R0003:Igf1r UTSW 7 68165242 missense probably damaging 1.00
R0184:Igf1r UTSW 7 68226193 missense possibly damaging 0.84
R0538:Igf1r UTSW 7 68207826 missense probably damaging 1.00
R0632:Igf1r UTSW 7 68165155 missense probably damaging 1.00
R0727:Igf1r UTSW 7 68212158 critical splice donor site probably null
R0750:Igf1r UTSW 7 68212091 missense probably damaging 0.99
R1104:Igf1r UTSW 7 68195026 missense possibly damaging 0.67
R1169:Igf1r UTSW 7 68165127 missense probably benign 0.00
R1348:Igf1r UTSW 7 68218468 missense probably damaging 1.00
R1471:Igf1r UTSW 7 68003837 missense probably damaging 0.98
R1580:Igf1r UTSW 7 68207869 missense probably benign
R1745:Igf1r UTSW 7 68169913 missense probably damaging 1.00
R1772:Igf1r UTSW 7 68195074 missense probably benign 0.03
R1789:Igf1r UTSW 7 68214933 nonsense probably null
R1823:Igf1r UTSW 7 68194981 missense possibly damaging 0.77
R1902:Igf1r UTSW 7 68201249 missense possibly damaging 0.93
R1962:Igf1r UTSW 7 68207275 missense probably damaging 0.99
R2179:Igf1r UTSW 7 68003950 missense probably damaging 0.99
R2215:Igf1r UTSW 7 68165234 missense probably benign
R2221:Igf1r UTSW 7 68201962 missense probably damaging 1.00
R2233:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R2234:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R2235:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R3023:Igf1r UTSW 7 68183399 missense probably benign 0.00
R4044:Igf1r UTSW 7 68190062 missense possibly damaging 0.83
R4226:Igf1r UTSW 7 68195078 nonsense probably null
R4387:Igf1r UTSW 7 68170009 missense probably benign
R4388:Igf1r UTSW 7 68170009 missense probably benign
R4728:Igf1r UTSW 7 68189624 missense probably damaging 1.00
R4781:Igf1r UTSW 7 68165199 missense possibly damaging 0.75
R5254:Igf1r UTSW 7 68207319 missense probably damaging 0.99
R5278:Igf1r UTSW 7 68193418 missense possibly damaging 0.78
R5522:Igf1r UTSW 7 68183510 missense probably damaging 0.96
R5527:Igf1r UTSW 7 68207821 missense probably damaging 1.00
R5761:Igf1r UTSW 7 68207253 missense probably damaging 1.00
R5849:Igf1r UTSW 7 68190033 missense probably benign
R6189:Igf1r UTSW 7 68207336 nonsense probably null
R6262:Igf1r UTSW 7 68003972 missense probably damaging 1.00
R6285:Igf1r UTSW 7 68004137 missense possibly damaging 0.94
R6318:Igf1r UTSW 7 68165233 missense probably benign 0.02
R6365:Igf1r UTSW 7 68190050 missense probably benign 0.26
R6377:Igf1r UTSW 7 68201250 missense probably benign 0.00
R6831:Igf1r UTSW 7 68207319 missense possibly damaging 0.75
R6848:Igf1r UTSW 7 68004179 missense probably damaging 1.00
R6902:Igf1r UTSW 7 68004163 missense probably damaging 1.00
R7193:Igf1r UTSW 7 68187157 missense probably damaging 1.00
R7373:Igf1r UTSW 7 68195078 nonsense probably null
R7442:Igf1r UTSW 7 68173278 missense probably damaging 1.00
R7903:Igf1r UTSW 7 68184752 missense probably damaging 1.00
R7923:Igf1r UTSW 7 68190101 missense probably damaging 1.00
R7932:Igf1r UTSW 7 68212054 missense possibly damaging 0.88
R8368:Igf1r UTSW 7 68187048 missense probably benign 0.03
R8458:Igf1r UTSW 7 68195629 missense probably benign
R8539:Igf1r UTSW 7 68003848 missense probably benign 0.06
R8704:Igf1r UTSW 7 68170054 splice site probably benign
R8746:Igf1r UTSW 7 68214997 missense probably damaging 1.00
R8829:Igf1r UTSW 7 68226021 missense probably damaging 1.00
R8832:Igf1r UTSW 7 68226021 missense probably damaging 1.00
R8859:Igf1r UTSW 7 68183463 missense possibly damaging 0.75
R9057:Igf1r UTSW 7 68183438 missense probably damaging 1.00
R9243:Igf1r UTSW 7 68212027 missense probably benign 0.11
R9342:Igf1r UTSW 7 68194998 missense probably benign 0.00
R9412:Igf1r UTSW 7 68207253 missense probably damaging 1.00
R9525:Igf1r UTSW 7 68214934 missense probably damaging 1.00
R9727:Igf1r UTSW 7 68207806 missense probably damaging 1.00
R9730:Igf1r UTSW 7 68189675 missense probably damaging 1.00
R9779:Igf1r UTSW 7 68004317 missense probably damaging 1.00
RF025:Igf1r UTSW 7 68226179 small insertion probably benign
RF032:Igf1r UTSW 7 68226179 small insertion probably benign
RF034:Igf1r UTSW 7 68226176 small insertion probably benign
RF037:Igf1r UTSW 7 68226176 small insertion probably benign
RF039:Igf1r UTSW 7 68226176 small insertion probably benign
RF044:Igf1r UTSW 7 68226179 small insertion probably benign
Z1186:Igf1r UTSW 7 68226168 small insertion probably benign
Z1186:Igf1r UTSW 7 68226169 small insertion probably benign
Z1186:Igf1r UTSW 7 68226174 small insertion probably benign
Z1186:Igf1r UTSW 7 68226180 small insertion probably benign
Z1186:Igf1r UTSW 7 68226182 small insertion probably benign
Z1191:Igf1r UTSW 7 68226169 small insertion probably benign
Z1191:Igf1r UTSW 7 68226170 small insertion probably benign
Z1191:Igf1r UTSW 7 68226173 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TGCACATGTTTCTCTGAGGATG -3'
(R):5'- GCAGCTGTGGATATCGATGC -3'

Sequencing Primer
(F):5'- TCTCAAGAGAGTACAGGATGGGTTG -3'
(R):5'- CTGTGGATATCGATGCGGTACAGAG -3'
Posted On 2016-10-05