Incidental Mutation 'R5510:Myh13'
ID431167
Institutional Source Beutler Lab
Gene Symbol Myh13
Ensembl Gene ENSMUSG00000060180
Gene Namemyosin, heavy polypeptide 13, skeletal muscle
SynonymsEO Myosin, extraocular myosin, MyHC-eo
MMRRC Submission 043071-MU
Accession Numbers

Genbank: NM_001081250; MGI: 1339967

Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R5510 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location67321658-67371586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67337723 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 363 (N363S)
Ref Sequence ENSEMBL: ENSMUSP00000137731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081911] [ENSMUST00000108684] [ENSMUST00000180845]
Predicted Effect probably benign
Transcript: ENSMUST00000081911
AA Change: N363S

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000080584
Gene: ENSMUSG00000060180
AA Change: N363S

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 8e-13 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
Pfam:Myosin_tail_1 847 1928 4.6e-159 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108684
AA Change: N363S

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000104324
Gene: ENSMUSG00000060180
AA Change: N363S

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180845
AA Change: N363S

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000137731
Gene: ENSMUSG00000060180
AA Change: N363S

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Meta Mutation Damage Score 0.3537 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.1%
Validation Efficiency 99% (91/92)
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,538,084 probably null Het
1700014D04Rik T C 13: 59,742,420 probably null Het
Adgrl4 T G 3: 151,497,830 I59R possibly damaging Het
Adgrv1 T A 13: 81,445,244 D4208V probably damaging Het
Aimp2 A T 5: 143,906,529 probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ankib1 A G 5: 3,729,693 V392A probably benign Het
Ap2b1 A G 11: 83,336,737 probably null Het
Arsg A G 11: 109,527,874 E232G probably benign Het
Axdnd1 A G 1: 156,335,350 F144S probably benign Het
Bud13 T A 9: 46,292,200 M111K probably damaging Het
Cav2 T C 6: 17,287,013 F152S possibly damaging Het
Ccdc180 A G 4: 45,928,046 T1194A probably damaging Het
Ccdc88c T C 12: 100,945,031 K848R probably damaging Het
Ceacam15 A G 7: 16,672,099 W176R probably damaging Het
Cenpf A T 1: 189,682,903 D136E probably benign Het
Dclk2 T C 3: 86,906,037 I201V possibly damaging Het
Defa24 T A 8: 21,734,596 D20E probably damaging Het
Dgcr8 T C 16: 18,277,175 N566D probably damaging Het
Dido1 C A 2: 180,685,173 V386L probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dtx3 G A 10: 127,192,938 P141S probably benign Het
Fmn1 T C 2: 113,596,369 Y1144H probably damaging Het
Gabbr2 A G 4: 46,734,113 L535P probably damaging Het
Gimap3 T A 6: 48,765,249 E249V possibly damaging Het
Git2 A T 5: 114,743,774 probably null Het
Gm4922 T C 10: 18,783,997 T326A probably benign Het
Gsdmc2 T G 15: 63,828,196 E242D probably benign Het
Hdgfl2 G A 17: 56,082,118 G31S possibly damaging Het
Herc2 A T 7: 56,206,771 I3956F probably damaging Het
Hsf2bp G A 17: 31,946,747 R134C unknown Het
Igf1r G C 7: 68,193,359 R739S probably benign Het
Igkv4-51 T C 6: 69,681,459 E102G probably damaging Het
Kif1a T G 1: 93,041,692 I1156L possibly damaging Het
Kti12 T C 4: 108,848,624 L245S probably damaging Het
Med17 A G 9: 15,270,404 S17P probably benign Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Mrps18b A G 17: 35,914,323 probably benign Het
Ms4a8a A G 19: 11,079,464 S85P probably benign Het
Msln T C 17: 25,749,873 Q487R probably benign Het
Myo6 T C 9: 80,245,660 F192L probably damaging Het
Nfkbiz T C 16: 55,814,020 D688G probably damaging Het
Nsun4 C T 4: 116,051,777 V529I possibly damaging Het
Olfr105-ps A T 17: 37,383,301 M245L probably benign Het
Olfr345 G A 2: 36,640,963 R308K probably benign Het
Olfr495 G A 7: 108,395,125 A2T probably benign Het
Phf11a C A 14: 59,279,385 C208F probably damaging Het
Plekhh2 G A 17: 84,566,847 C520Y probably benign Het
Plxna4 C A 6: 32,178,358 M1550I probably damaging Het
Pnpla6 A T 8: 3,521,397 Y140F probably damaging Het
Ppp1r12a T A 10: 108,249,627 S478T possibly damaging Het
Prkcz C A 4: 155,272,936 probably null Het
Prss55 T A 14: 64,077,125 M199L probably damaging Het
Qrich1 G A 9: 108,556,460 V651I possibly damaging Het
Ralyl T C 3: 13,776,945 V47A probably damaging Het
Raph1 A T 1: 60,522,946 probably benign Het
Rgs12 T C 5: 34,966,039 Y389H probably damaging Het
Sec24b C A 3: 130,040,895 G82V probably damaging Het
Sema4a A G 3: 88,449,986 probably null Het
Slc25a11 A T 11: 70,645,535 W149R probably damaging Het
Slc2a7 T G 4: 150,160,094 S340A probably benign Het
Slc32a1 T A 2: 158,614,796 M457K probably damaging Het
Spint4 C T 2: 164,700,892 T135M probably damaging Het
Sult2a2 A C 7: 13,738,303 N142H probably damaging Het
Tbc1d1 G A 5: 64,333,395 G863D probably damaging Het
Tmem156 G A 5: 65,075,574 T151M probably benign Het
Trip12 T C 1: 84,768,680 Q459R probably damaging Het
Vmn2r116 G A 17: 23,386,121 C136Y probably damaging Het
Vmn2r51 C T 7: 10,102,618 V79M possibly damaging Het
Vmn2r67 A T 7: 85,151,815 D304E probably benign Het
Wdr93 T A 7: 79,750,031 F123I probably damaging Het
Zfp672 A T 11: 58,316,630 C288* probably null Het
Zp1 T C 19: 10,919,405 Y90C probably damaging Het
Other mutations in Myh13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Myh13 APN 11 67342488 missense probably damaging 1.00
IGL00808:Myh13 APN 11 67335004 critical splice donor site probably null
IGL00822:Myh13 APN 11 67361328 missense probably damaging 0.98
IGL00823:Myh13 APN 11 67355947 missense probably benign 0.00
IGL00945:Myh13 APN 11 67348006 missense probably null 1.00
IGL01414:Myh13 APN 11 67342472 missense probably benign 0.02
IGL01482:Myh13 APN 11 67352068 missense probably benign
IGL01523:Myh13 APN 11 67347943 missense possibly damaging 0.73
IGL01723:Myh13 APN 11 67369219 unclassified probably benign
IGL01997:Myh13 APN 11 67367166 missense probably benign 0.14
IGL02369:Myh13 APN 11 67360274 unclassified probably benign
IGL02478:Myh13 APN 11 67369378 missense probably benign
IGL02663:Myh13 APN 11 67354927 nonsense probably null
IGL02851:Myh13 APN 11 67348916 missense possibly damaging 0.92
IGL02863:Myh13 APN 11 67332541 missense probably damaging 1.00
IGL02929:Myh13 APN 11 67367165 missense probably damaging 1.00
IGL02979:Myh13 APN 11 67334962 missense possibly damaging 0.72
IGL03065:Myh13 APN 11 67344853 missense probably damaging 0.99
IGL03214:Myh13 APN 11 67353585 missense possibly damaging 0.79
IGL03223:Myh13 APN 11 67350242 missense probably benign 0.39
IGL03231:Myh13 APN 11 67351991 missense possibly damaging 0.94
IGL03407:Myh13 APN 11 67352152 missense probably damaging 1.00
3-1:Myh13 UTSW 11 67351951 splice site probably benign
P0042:Myh13 UTSW 11 67334991 missense probably benign 0.00
R0047:Myh13 UTSW 11 67367237 missense probably benign 0.00
R0047:Myh13 UTSW 11 67367237 missense probably benign 0.00
R0379:Myh13 UTSW 11 67369295 unclassified probably benign
R0496:Myh13 UTSW 11 67348815 missense probably damaging 1.00
R0584:Myh13 UTSW 11 67360374 nonsense probably null
R0595:Myh13 UTSW 11 67344846 missense probably benign 0.03
R0621:Myh13 UTSW 11 67341232 missense probably damaging 0.98
R0834:Myh13 UTSW 11 67349610 missense possibly damaging 0.88
R0893:Myh13 UTSW 11 67334601 missense probably damaging 1.00
R0964:Myh13 UTSW 11 67345002 missense probably benign 0.02
R0973:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R0973:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R0974:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R1028:Myh13 UTSW 11 67356181 missense possibly damaging 0.71
R1112:Myh13 UTSW 11 67354750 missense probably damaging 1.00
R1283:Myh13 UTSW 11 67370921 missense probably damaging 1.00
R1288:Myh13 UTSW 11 67353718 missense probably benign 0.00
R1386:Myh13 UTSW 11 67370950 missense possibly damaging 0.79
R1457:Myh13 UTSW 11 67331046 missense probably damaging 0.97
R1503:Myh13 UTSW 11 67353674 missense probably benign 0.43
R1574:Myh13 UTSW 11 67362581 unclassified probably benign
R1673:Myh13 UTSW 11 67352119 missense possibly damaging 0.79
R1693:Myh13 UTSW 11 67341484 missense possibly damaging 0.95
R1763:Myh13 UTSW 11 67334576 missense probably benign
R2029:Myh13 UTSW 11 67361289 missense probably benign 0.03
R2030:Myh13 UTSW 11 67350238 missense probably benign
R2247:Myh13 UTSW 11 67334558 missense probably damaging 0.96
R2393:Myh13 UTSW 11 67340358 missense possibly damaging 0.93
R2395:Myh13 UTSW 11 67364922 missense probably benign 0.12
R2884:Myh13 UTSW 11 67337643 missense probably benign 0.27
R3696:Myh13 UTSW 11 67345044 missense possibly damaging 0.55
R3786:Myh13 UTSW 11 67327188 missense probably benign 0.01
R3875:Myh13 UTSW 11 67358194 missense probably benign 0.26
R3918:Myh13 UTSW 11 67329238 missense probably benign 0.00
R4061:Myh13 UTSW 11 67330889 missense possibly damaging 0.71
R4160:Myh13 UTSW 11 67364810 intron probably benign
R4183:Myh13 UTSW 11 67349610 missense possibly damaging 0.88
R4392:Myh13 UTSW 11 67344881 splice site probably null
R4639:Myh13 UTSW 11 67341551 missense possibly damaging 0.91
R4670:Myh13 UTSW 11 67364738 nonsense probably null
R4783:Myh13 UTSW 11 67341270 missense probably damaging 1.00
R4877:Myh13 UTSW 11 67337651 missense probably damaging 0.99
R5250:Myh13 UTSW 11 67327259 nonsense probably null
R5278:Myh13 UTSW 11 67334564 missense probably benign 0.00
R5371:Myh13 UTSW 11 67344790 splice site probably null
R5479:Myh13 UTSW 11 67348822 missense probably damaging 0.97
R5690:Myh13 UTSW 11 67329275 missense probably damaging 1.00
R5797:Myh13 UTSW 11 67335002 missense possibly damaging 0.66
R5823:Myh13 UTSW 11 67360468 missense probably damaging 1.00
R5877:Myh13 UTSW 11 67353658 missense possibly damaging 0.78
R6041:Myh13 UTSW 11 67364730 missense probably damaging 1.00
R6175:Myh13 UTSW 11 67354762 missense probably benign 0.00
R6244:Myh13 UTSW 11 67362501 missense probably benign 0.00
R6454:Myh13 UTSW 11 67350365 missense probably benign 0.03
R6617:Myh13 UTSW 11 67361400 missense probably benign 0.00
R6707:Myh13 UTSW 11 67350260 missense probably damaging 1.00
R6747:Myh13 UTSW 11 67350419 missense probably damaging 0.99
R6823:Myh13 UTSW 11 67356158 missense probably benign
R6911:Myh13 UTSW 11 67354927 nonsense probably null
R6997:Myh13 UTSW 11 67327154 nonsense probably null
R7033:Myh13 UTSW 11 67369316 missense possibly damaging 0.92
R7145:Myh13 UTSW 11 67354740 missense probably benign 0.08
R7232:Myh13 UTSW 11 67348846 missense probably damaging 1.00
R7428:Myh13 UTSW 11 67332564 missense probably damaging 1.00
R7448:Myh13 UTSW 11 67364460 critical splice acceptor site probably null
R7474:Myh13 UTSW 11 67327164 missense possibly damaging 0.93
R7474:Myh13 UTSW 11 67367711 missense
R7766:Myh13 UTSW 11 67358329 missense probably benign 0.37
R7809:Myh13 UTSW 11 67350341 missense probably benign 0.14
R7813:Myh13 UTSW 11 67327230 missense probably benign 0.27
Z1176:Myh13 UTSW 11 67329295 missense possibly damaging 0.93
Z1177:Myh13 UTSW 11 67350452 missense possibly damaging 0.55
Z1177:Myh13 UTSW 11 67364591 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGGGAGAGGTTACAGCTAGTTC -3'
(R):5'- GGACAACTCAAATGCAGGGC -3'

Sequencing Primer
(F):5'- GGAGAGGTTACAGCTAGTTCTTATC -3'
(R):5'- TGCAGGGCATATAATTTTGGAAG -3'
Posted On2016-10-05