Incidental Mutation 'R5511:Zdbf2'
ID431198
Institutional Source Beutler Lab
Gene Symbol Zdbf2
Ensembl Gene ENSMUSG00000027520
Gene Namezinc finger, DBF-type containing 2
Synonyms4930431J08Rik, 9330107J05Rik
MMRRC Submission 043072-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R5511 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location63273265-63314576 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63305677 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1072 (S1072P)
Ref Sequence ENSEMBL: ENSMUSP00000109767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]
Predicted Effect probably benign
Transcript: ENSMUST00000029025
AA Change: S1072P

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: S1072P

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114132
AA Change: S1072P

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: S1072P

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.1%
  • 20x: 90.3%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,538,084 probably null Het
Agl A T 3: 116,788,560 V271D possibly damaging Het
Alox15 G T 11: 70,349,982 P191T probably benign Het
Apaf1 T C 10: 91,054,392 Y583C probably damaging Het
Aqp9 T A 9: 71,163,093 probably benign Het
Bms1 A G 6: 118,388,887 F1113L possibly damaging Het
Cap1 A C 4: 122,862,790 probably benign Het
Car11 T C 7: 45,700,461 W35R probably damaging Het
Casc3 T A 11: 98,810,914 Y91* probably null Het
Cd22 A T 7: 30,870,071 I540N probably damaging Het
Chad A T 11: 94,565,246 E50V probably damaging Het
Chd3 C G 11: 69,361,475 G34R probably damaging Het
Col9a1 T C 1: 24,179,538 V77A unknown Het
Copg1 G A 6: 87,912,294 V873M probably damaging Het
Dnhd1 T A 7: 105,714,156 V3975E probably damaging Het
Dock6 A T 9: 21,817,407 V1290D possibly damaging Het
Elp2 A T 18: 24,612,450 K150* probably null Het
Eri3 A C 4: 117,615,189 Y260S possibly damaging Het
Esrrg C T 1: 188,211,107 L426F probably damaging Het
Farp1 G T 14: 121,237,172 V266L probably damaging Het
Flnc A G 6: 29,458,898 E2459G probably damaging Het
Glis1 G A 4: 107,435,877 D66N probably damaging Het
Gm14129 T A 2: 148,931,526 noncoding transcript Het
Gm28051 A G 12: 102,720,156 *82R probably null Het
Gm5538 T C 3: 59,747,264 L173P probably damaging Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Gne C T 4: 44,041,843 V485M probably damaging Het
Lcn10 T A 2: 25,682,829 V15E probably benign Het
Mapk11 T A 15: 89,145,177 probably null Het
Me3 T G 7: 89,806,668 Y243D probably damaging Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Myo1h T A 5: 114,345,897 L519* probably null Het
Myo9a T C 9: 59,780,212 V200A probably damaging Het
Mzf1 T A 7: 13,051,599 Q161H possibly damaging Het
Nim1k T G 13: 119,727,594 H93P probably damaging Het
Nkx6-1 C A 5: 101,663,666 R190L probably damaging Het
Noc3l A G 19: 38,794,181 V671A probably benign Het
Nsd1 T C 13: 55,312,730 S2257P probably benign Het
Nup210 T A 6: 91,026,963 I648F probably damaging Het
Olfr1477 T C 19: 13,503,192 M283T probably benign Het
Oplah T C 15: 76,305,744 E223G possibly damaging Het
Plekhs1 A C 19: 56,485,792 T457P probably damaging Het
Plppr4 G A 3: 117,325,902 T286I probably benign Het
Prpf4b T C 13: 34,884,054 probably benign Het
Prss39 T A 1: 34,502,797 D318E possibly damaging Het
Psap A G 10: 60,299,180 E289G possibly damaging Het
Rad17 A G 13: 100,627,649 V438A possibly damaging Het
Raf1 T C 6: 115,620,256 S28G probably benign Het
Ranbp2 A G 10: 58,493,739 D2978G probably benign Het
Rnf170 T A 8: 26,140,999 D213E probably damaging Het
Rsph3a T A 17: 7,946,073 H88Q possibly damaging Het
Scd1 A G 19: 44,406,759 I9T probably benign Het
Sgk3 T C 1: 9,898,686 probably benign Het
Slc14a1 C T 18: 78,102,471 S416N probably benign Het
Smok4a T C 17: 13,526,212 noncoding transcript Het
Sostdc1 A T 12: 36,317,166 I114F probably damaging Het
Spen G T 4: 141,516,838 D295E unknown Het
Spen G A 4: 141,475,064 T2084I possibly damaging Het
Sptbn5 T C 2: 120,059,721 probably benign Het
Srebf1 T C 11: 60,210,358 probably benign Het
Tcea3 A T 4: 136,271,372 Y319F probably damaging Het
Timd4 T A 11: 46,819,980 probably null Het
Tmem88b G A 4: 155,785,545 P20S probably damaging Het
Tsen2 T A 6: 115,561,404 C281S probably damaging Het
Vmn2r28 T C 7: 5,484,012 T551A possibly damaging Het
Vmn2r45 T C 7: 8,471,833 H732R probably benign Het
Wdr90 A G 17: 25,845,021 probably benign Het
Zfp148 A G 16: 33,434,634 probably benign Het
Zfp2 T A 11: 50,900,024 E397D probably damaging Het
Zfp729b A G 13: 67,592,380 F599L probably damaging Het
Other mutations in Zdbf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Zdbf2 APN 1 63306514 missense possibly damaging 0.92
IGL00796:Zdbf2 APN 1 63307205 missense probably benign 0.04
IGL00801:Zdbf2 APN 1 63303038 missense possibly damaging 0.66
IGL02803:Zdbf2 APN 1 63303077 missense possibly damaging 0.46
R0143:Zdbf2 UTSW 1 63308074 missense probably benign 0.01
R0147:Zdbf2 UTSW 1 63304006 nonsense probably null
R0148:Zdbf2 UTSW 1 63304006 nonsense probably null
R0433:Zdbf2 UTSW 1 63306143 missense possibly damaging 0.46
R0502:Zdbf2 UTSW 1 63305290 missense possibly damaging 0.66
R0645:Zdbf2 UTSW 1 63304950 missense possibly damaging 0.81
R0765:Zdbf2 UTSW 1 63305723 missense possibly damaging 0.46
R1068:Zdbf2 UTSW 1 63303430 missense possibly damaging 0.94
R1216:Zdbf2 UTSW 1 63303002 missense possibly damaging 0.83
R1235:Zdbf2 UTSW 1 63309073 missense possibly damaging 0.66
R1352:Zdbf2 UTSW 1 63303053 missense probably damaging 0.96
R1402:Zdbf2 UTSW 1 63303627 missense possibly damaging 0.46
R1402:Zdbf2 UTSW 1 63303627 missense possibly damaging 0.46
R1435:Zdbf2 UTSW 1 63303040 missense possibly damaging 0.66
R1562:Zdbf2 UTSW 1 63303588 missense possibly damaging 0.83
R1624:Zdbf2 UTSW 1 63303859 missense possibly damaging 0.66
R1635:Zdbf2 UTSW 1 63304334 missense possibly damaging 0.92
R1644:Zdbf2 UTSW 1 63308972 missense possibly damaging 0.66
R1662:Zdbf2 UTSW 1 63304249 nonsense probably null
R1700:Zdbf2 UTSW 1 63302741 missense unknown
R1720:Zdbf2 UTSW 1 63303277 missense possibly damaging 0.46
R1853:Zdbf2 UTSW 1 63305542 frame shift probably null
R1854:Zdbf2 UTSW 1 63305542 frame shift probably null
R1973:Zdbf2 UTSW 1 63309701 missense unknown
R2336:Zdbf2 UTSW 1 63303464 missense probably benign 0.00
R2428:Zdbf2 UTSW 1 63305615 missense probably benign 0.04
R3010:Zdbf2 UTSW 1 63303065 missense possibly damaging 0.92
R3034:Zdbf2 UTSW 1 63304205 missense probably damaging 0.96
R3079:Zdbf2 UTSW 1 63307477 missense probably benign 0.05
R3196:Zdbf2 UTSW 1 63308420 missense possibly damaging 0.46
R3711:Zdbf2 UTSW 1 63308671 missense possibly damaging 0.83
R3845:Zdbf2 UTSW 1 63308324 missense possibly damaging 0.66
R4093:Zdbf2 UTSW 1 63309781 missense possibly damaging 0.83
R4250:Zdbf2 UTSW 1 63302861 missense possibly damaging 0.46
R4592:Zdbf2 UTSW 1 63306591 missense possibly damaging 0.82
R4721:Zdbf2 UTSW 1 63308792 missense possibly damaging 0.46
R4779:Zdbf2 UTSW 1 63303238 missense possibly damaging 0.66
R4928:Zdbf2 UTSW 1 63308814 missense possibly damaging 0.81
R4943:Zdbf2 UTSW 1 63302914 missense possibly damaging 0.92
R5025:Zdbf2 UTSW 1 63303650 missense possibly damaging 0.82
R5095:Zdbf2 UTSW 1 63309073 missense possibly damaging 0.66
R5149:Zdbf2 UTSW 1 63304903 missense possibly damaging 0.83
R5326:Zdbf2 UTSW 1 63304411 missense possibly damaging 0.66
R5341:Zdbf2 UTSW 1 63307933 missense probably benign 0.27
R5809:Zdbf2 UTSW 1 63305876 missense possibly damaging 0.90
R5902:Zdbf2 UTSW 1 63306526 missense possibly damaging 0.83
R6162:Zdbf2 UTSW 1 63280818 start gained probably benign
R6245:Zdbf2 UTSW 1 63304433 missense possibly damaging 0.46
R6332:Zdbf2 UTSW 1 63307822 missense possibly damaging 0.66
R6361:Zdbf2 UTSW 1 63303321 missense possibly damaging 0.66
R6489:Zdbf2 UTSW 1 63307478 missense possibly damaging 0.46
R6517:Zdbf2 UTSW 1 63305520 missense possibly damaging 0.81
R6624:Zdbf2 UTSW 1 63303914 missense possibly damaging 0.46
R6643:Zdbf2 UTSW 1 63304508 missense possibly damaging 0.82
R6786:Zdbf2 UTSW 1 63304520 missense possibly damaging 0.46
R6808:Zdbf2 UTSW 1 63308528 missense possibly damaging 0.66
R6896:Zdbf2 UTSW 1 63308872 missense probably damaging 0.98
R6997:Zdbf2 UTSW 1 63290766 missense probably benign 0.09
R7011:Zdbf2 UTSW 1 63306766 missense possibly damaging 0.66
R7058:Zdbf2 UTSW 1 63307404 missense possibly damaging 0.66
R7066:Zdbf2 UTSW 1 63307559 missense probably benign
R7177:Zdbf2 UTSW 1 63294961 missense possibly damaging 0.94
R7184:Zdbf2 UTSW 1 63306505 missense possibly damaging 0.92
R7273:Zdbf2 UTSW 1 63303404 missense possibly damaging 0.90
R7387:Zdbf2 UTSW 1 63304039 missense possibly damaging 0.46
R7468:Zdbf2 UTSW 1 63307510 missense probably benign
R7695:Zdbf2 UTSW 1 63307370 missense possibly damaging 0.83
R7712:Zdbf2 UTSW 1 63305371 missense possibly damaging 0.83
R7735:Zdbf2 UTSW 1 63304105 missense possibly damaging 0.66
R7736:Zdbf2 UTSW 1 63308007 nonsense probably null
R7759:Zdbf2 UTSW 1 63308376 missense possibly damaging 0.46
R7796:Zdbf2 UTSW 1 63303424 missense possibly damaging 0.90
R7908:Zdbf2 UTSW 1 63306827 missense possibly damaging 0.46
R7989:Zdbf2 UTSW 1 63306827 missense possibly damaging 0.46
RF021:Zdbf2 UTSW 1 63302652 missense possibly damaging 0.82
X0018:Zdbf2 UTSW 1 63305351 missense possibly damaging 0.92
X0027:Zdbf2 UTSW 1 63308007 nonsense probably null
X0057:Zdbf2 UTSW 1 63305390 missense possibly damaging 0.66
X0063:Zdbf2 UTSW 1 63305537 missense probably benign 0.04
Z1176:Zdbf2 UTSW 1 63304245 missense not run
Z1177:Zdbf2 UTSW 1 63304086 frame shift probably null
Z1177:Zdbf2 UTSW 1 63309203 missense not run
Predicted Primers PCR Primer
(F):5'- GCTCTCAACCAACTTTCAAGTTTG -3'
(R):5'- TCAAGTTGATCCATTGCAGAACG -3'

Sequencing Primer
(F):5'- GATGTTTTTCCTCGGACAATGAC -3'
(R):5'- TTGATCCATTGCAGAACGAAAAG -3'
Posted On2016-10-05