Mutagenetix > Incidental Mutation

Incidental Mutation 'R5511:Zdbf2'

431198

Institutional Source

Beutler Lab

Gene Symbol

Zdbf2

Ensembl Gene

ENSMUSG00000027520

Gene Name

zinc finger, DBF-type containing 2

Synonyms

4930431J08Rik, 9330107J05Rik

MMRRC Submission

043072-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.111) question?

Stock #

R5511 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

63273265-63314576 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 63305677 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1072 (S1072P)

Ref Sequence

ENSEMBL: ENSMUSP00000109767 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]

AlphaFold

Q5SS00

Predicted Effect

probably benign
Transcript: ENSMUST00000029025
AA Change: S1072P

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: S1072P

Domain	Start	End	E-Value	Type
low complexity region	79	99	N/A	INTRINSIC
low complexity region	150	164	N/A	INTRINSIC
low complexity region	378	405	N/A	INTRINSIC
internal_repeat_6	407	565	7.68e-5	PROSPERO
internal_repeat_5	418	768	5.53e-5	PROSPERO
internal_repeat_1	618	873	3.17e-15	PROSPERO
internal_repeat_4	621	885	2.09e-6	PROSPERO
internal_repeat_3	642	886	1.52e-7	PROSPERO
internal_repeat_2	650	912	5.87e-11	PROSPERO
internal_repeat_6	722	891	7.68e-5	PROSPERO
low complexity region	965	982	N/A	INTRINSIC
internal_repeat_4	1061	1328	2.09e-6	PROSPERO
internal_repeat_2	1215	1484	5.87e-11	PROSPERO
internal_repeat_3	1287	1507	1.52e-7	PROSPERO
internal_repeat_1	1307	1536	3.17e-15	PROSPERO
internal_repeat_5	1388	1758	5.53e-5	PROSPERO
low complexity region	1767	1778	N/A	INTRINSIC
low complexity region	2211	2235	N/A	INTRINSIC
low complexity region	2240	2399	N/A	INTRINSIC
low complexity region	2402	2420	N/A	INTRINSIC
low complexity region	2446	2458	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114132
AA Change: S1072P

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: S1072P

Domain	Start	End	E-Value	Type
low complexity region	79	99	N/A	INTRINSIC
low complexity region	150	164	N/A	INTRINSIC
low complexity region	378	405	N/A	INTRINSIC
internal_repeat_6	407	565	7.68e-5	PROSPERO
internal_repeat_5	418	768	5.53e-5	PROSPERO
internal_repeat_1	618	873	3.17e-15	PROSPERO
internal_repeat_4	621	885	2.09e-6	PROSPERO
internal_repeat_3	642	886	1.52e-7	PROSPERO
internal_repeat_2	650	912	5.87e-11	PROSPERO
internal_repeat_6	722	891	7.68e-5	PROSPERO
low complexity region	965	982	N/A	INTRINSIC
internal_repeat_4	1061	1328	2.09e-6	PROSPERO
internal_repeat_2	1215	1484	5.87e-11	PROSPERO
internal_repeat_3	1287	1507	1.52e-7	PROSPERO
internal_repeat_1	1307	1536	3.17e-15	PROSPERO
internal_repeat_5	1388	1758	5.53e-5	PROSPERO
low complexity region	1767	1778	N/A	INTRINSIC
low complexity region	2211	2235	N/A	INTRINSIC
low complexity region	2240	2399	N/A	INTRINSIC
low complexity region	2402	2420	N/A	INTRINSIC
low complexity region	2446	2458	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.5%
3x: 97.4%
10x: 95.1%
20x: 90.3%

Validation Efficiency

98% (81/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011I03Rik	G	A	18: 57,538,084		probably null	Het
Agl	A	T	3: 116,788,560	V271D	possibly damaging	Het
Alox15	G	T	11: 70,349,982	P191T	probably benign	Het
Apaf1	T	C	10: 91,054,392	Y583C	probably damaging	Het
Aqp9	T	A	9: 71,163,093		probably benign	Het
Bms1	A	G	6: 118,388,887	F1113L	possibly damaging	Het
Cap1	A	C	4: 122,862,790		probably benign	Het
Car11	T	C	7: 45,700,461	W35R	probably damaging	Het
Casc3	T	A	11: 98,810,914	Y91*	probably null	Het
Cd22	A	T	7: 30,870,071	I540N	probably damaging	Het
Chad	A	T	11: 94,565,246	E50V	probably damaging	Het
Chd3	C	G	11: 69,361,475	G34R	probably damaging	Het
Col9a1	T	C	1: 24,179,538	V77A	unknown	Het
Copg1	G	A	6: 87,912,294	V873M	probably damaging	Het
Dnhd1	T	A	7: 105,714,156	V3975E	probably damaging	Het
Dock6	A	T	9: 21,817,407	V1290D	possibly damaging	Het
Elp2	A	T	18: 24,612,450	K150*	probably null	Het
Eri3	A	C	4: 117,615,189	Y260S	possibly damaging	Het
Esrrg	C	T	1: 188,211,107	L426F	probably damaging	Het
Farp1	G	T	14: 121,237,172	V266L	probably damaging	Het
Flnc	A	G	6: 29,458,898	E2459G	probably damaging	Het
Glis1	G	A	4: 107,435,877	D66N	probably damaging	Het
Gm14129	T	A	2: 148,931,526		noncoding transcript	Het
Gm28051	A	G	12: 102,720,156	*82R	probably null	Het
Gm5538	T	C	3: 59,747,264	L173P	probably damaging	Het
Gm8741	G	T	17: 35,336,086		noncoding transcript	Het
Gne	C	T	4: 44,041,843	V485M	probably damaging	Het
Lcn10	T	A	2: 25,682,829	V15E	probably benign	Het
Mapk11	T	A	15: 89,145,177		probably null	Het
Me3	T	G	7: 89,806,668	Y243D	probably damaging	Het
Mllt6	G	A	11: 97,669,500	S210N	possibly damaging	Het
Myo1h	T	A	5: 114,345,897	L519*	probably null	Het
Myo9a	T	C	9: 59,780,212	V200A	probably damaging	Het
Mzf1	T	A	7: 13,051,599	Q161H	possibly damaging	Het
Nim1k	T	G	13: 119,727,594	H93P	probably damaging	Het
Nkx6-1	C	A	5: 101,663,666	R190L	probably damaging	Het
Noc3l	A	G	19: 38,794,181	V671A	probably benign	Het
Nsd1	T	C	13: 55,312,730	S2257P	probably benign	Het
Nup210	T	A	6: 91,026,963	I648F	probably damaging	Het
Olfr1477	T	C	19: 13,503,192	M283T	probably benign	Het
Oplah	T	C	15: 76,305,744	E223G	possibly damaging	Het
Plekhs1	A	C	19: 56,485,792	T457P	probably damaging	Het
Plppr4	G	A	3: 117,325,902	T286I	probably benign	Het
Prpf4b	T	C	13: 34,884,054		probably benign	Het
Prss39	T	A	1: 34,502,797	D318E	possibly damaging	Het
Psap	A	G	10: 60,299,180	E289G	possibly damaging	Het
Rad17	A	G	13: 100,627,649	V438A	possibly damaging	Het
Raf1	T	C	6: 115,620,256	S28G	probably benign	Het
Ranbp2	A	G	10: 58,493,739	D2978G	probably benign	Het
Rnf170	T	A	8: 26,140,999	D213E	probably damaging	Het
Rsph3a	T	A	17: 7,946,073	H88Q	possibly damaging	Het
Scd1	A	G	19: 44,406,759	I9T	probably benign	Het
Sgk3	T	C	1: 9,898,686		probably benign	Het
Slc14a1	C	T	18: 78,102,471	S416N	probably benign	Het
Smok4a	T	C	17: 13,526,212		noncoding transcript	Het
Sostdc1	A	T	12: 36,317,166	I114F	probably damaging	Het
Spen	G	T	4: 141,516,838	D295E	unknown	Het
Spen	G	A	4: 141,475,064	T2084I	possibly damaging	Het
Sptbn5	T	C	2: 120,059,721		probably benign	Het
Srebf1	T	C	11: 60,210,358		probably benign	Het
Tcea3	A	T	4: 136,271,372	Y319F	probably damaging	Het
Timd4	T	A	11: 46,819,980		probably null	Het
Tmem88b	G	A	4: 155,785,545	P20S	probably damaging	Het
Tsen2	T	A	6: 115,561,404	C281S	probably damaging	Het
Vmn2r28	T	C	7: 5,484,012	T551A	possibly damaging	Het
Vmn2r45	T	C	7: 8,471,833	H732R	probably benign	Het
Wdr90	A	G	17: 25,845,021		probably benign	Het
Zfp148	A	G	16: 33,434,634		probably benign	Het
Zfp2	T	A	11: 50,900,024	E397D	probably damaging	Het
Zfp729b	A	G	13: 67,592,380	F599L	probably damaging	Het

Other mutations in Zdbf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00790:Zdbf2	APN	1	63306514	missense	possibly damaging	0.92
IGL00796:Zdbf2	APN	1	63307205	missense	probably benign	0.04
IGL00801:Zdbf2	APN	1	63303038	missense	possibly damaging	0.66
IGL02803:Zdbf2	APN	1	63303077	missense	possibly damaging	0.46
R0143:Zdbf2	UTSW	1	63308074	missense	probably benign	0.01
R0147:Zdbf2	UTSW	1	63304006	nonsense	probably null
R0148:Zdbf2	UTSW	1	63304006	nonsense	probably null
R0433:Zdbf2	UTSW	1	63306143	missense	possibly damaging	0.46
R0502:Zdbf2	UTSW	1	63305290	missense	possibly damaging	0.66
R0645:Zdbf2	UTSW	1	63304950	missense	possibly damaging	0.81
R0765:Zdbf2	UTSW	1	63305723	missense	possibly damaging	0.46
R1068:Zdbf2	UTSW	1	63303430	missense	possibly damaging	0.94
R1216:Zdbf2	UTSW	1	63303002	missense	possibly damaging	0.83
R1235:Zdbf2	UTSW	1	63309073	missense	possibly damaging	0.66
R1352:Zdbf2	UTSW	1	63303053	missense	probably damaging	0.96
R1402:Zdbf2	UTSW	1	63303627	missense	possibly damaging	0.46
R1402:Zdbf2	UTSW	1	63303627	missense	possibly damaging	0.46
R1435:Zdbf2	UTSW	1	63303040	missense	possibly damaging	0.66
R1562:Zdbf2	UTSW	1	63303588	missense	possibly damaging	0.83
R1624:Zdbf2	UTSW	1	63303859	missense	possibly damaging	0.66
R1635:Zdbf2	UTSW	1	63304334	missense	possibly damaging	0.92
R1644:Zdbf2	UTSW	1	63308972	missense	possibly damaging	0.66
R1662:Zdbf2	UTSW	1	63304249	nonsense	probably null
R1700:Zdbf2	UTSW	1	63302741	missense	unknown
R1720:Zdbf2	UTSW	1	63303277	missense	possibly damaging	0.46
R1853:Zdbf2	UTSW	1	63305542	frame shift	probably null
R1854:Zdbf2	UTSW	1	63305542	frame shift	probably null
R1973:Zdbf2	UTSW	1	63309701	missense	unknown
R2336:Zdbf2	UTSW	1	63303464	missense	probably benign	0.00
R2428:Zdbf2	UTSW	1	63305615	missense	probably benign	0.04
R3010:Zdbf2	UTSW	1	63303065	missense	possibly damaging	0.92
R3034:Zdbf2	UTSW	1	63304205	missense	probably damaging	0.96
R3079:Zdbf2	UTSW	1	63307477	missense	probably benign	0.05
R3196:Zdbf2	UTSW	1	63308420	missense	possibly damaging	0.46
R3711:Zdbf2	UTSW	1	63308671	missense	possibly damaging	0.83
R3845:Zdbf2	UTSW	1	63308324	missense	possibly damaging	0.66
R4093:Zdbf2	UTSW	1	63309781	missense	possibly damaging	0.83
R4250:Zdbf2	UTSW	1	63302861	missense	possibly damaging	0.46
R4592:Zdbf2	UTSW	1	63306591	missense	possibly damaging	0.82
R4721:Zdbf2	UTSW	1	63308792	missense	possibly damaging	0.46
R4779:Zdbf2	UTSW	1	63303238	missense	possibly damaging	0.66
R4928:Zdbf2	UTSW	1	63308814	missense	possibly damaging	0.81
R4943:Zdbf2	UTSW	1	63302914	missense	possibly damaging	0.92
R5025:Zdbf2	UTSW	1	63303650	missense	possibly damaging	0.82
R5095:Zdbf2	UTSW	1	63309073	missense	possibly damaging	0.66
R5149:Zdbf2	UTSW	1	63304903	missense	possibly damaging	0.83
R5326:Zdbf2	UTSW	1	63304411	missense	possibly damaging	0.66
R5341:Zdbf2	UTSW	1	63307933	missense	probably benign	0.27
R5809:Zdbf2	UTSW	1	63305876	missense	possibly damaging	0.90
R5902:Zdbf2	UTSW	1	63306526	missense	possibly damaging	0.83
R6162:Zdbf2	UTSW	1	63280818	start gained	probably benign
R6245:Zdbf2	UTSW	1	63304433	missense	possibly damaging	0.46
R6332:Zdbf2	UTSW	1	63307822	missense	possibly damaging	0.66
R6361:Zdbf2	UTSW	1	63303321	missense	possibly damaging	0.66
R6489:Zdbf2	UTSW	1	63307478	missense	possibly damaging	0.46
R6517:Zdbf2	UTSW	1	63305520	missense	possibly damaging	0.81
R6624:Zdbf2	UTSW	1	63303914	missense	possibly damaging	0.46
R6643:Zdbf2	UTSW	1	63304508	missense	possibly damaging	0.82
R6786:Zdbf2	UTSW	1	63304520	missense	possibly damaging	0.46
R6808:Zdbf2	UTSW	1	63308528	missense	possibly damaging	0.66
R6896:Zdbf2	UTSW	1	63308872	missense	probably damaging	0.98
R6997:Zdbf2	UTSW	1	63290766	missense	probably benign	0.09
R7011:Zdbf2	UTSW	1	63306766	missense	possibly damaging	0.66
R7058:Zdbf2	UTSW	1	63307404	missense	possibly damaging	0.66
R7066:Zdbf2	UTSW	1	63307559	missense	probably benign
R7177:Zdbf2	UTSW	1	63294961	missense	possibly damaging	0.94
R7184:Zdbf2	UTSW	1	63306505	missense	possibly damaging	0.92
R7273:Zdbf2	UTSW	1	63303404	missense	possibly damaging	0.90
R7387:Zdbf2	UTSW	1	63304039	missense	possibly damaging	0.46
R7468:Zdbf2	UTSW	1	63307510	missense	probably benign
R7695:Zdbf2	UTSW	1	63307370	missense	possibly damaging	0.83
R7712:Zdbf2	UTSW	1	63305371	missense	possibly damaging	0.83
R7735:Zdbf2	UTSW	1	63304105	missense	possibly damaging	0.66
R7736:Zdbf2	UTSW	1	63308007	nonsense	probably null
R7759:Zdbf2	UTSW	1	63308376	missense	possibly damaging	0.46
R7796:Zdbf2	UTSW	1	63303424	missense	possibly damaging	0.90
R7908:Zdbf2	UTSW	1	63306827	missense	possibly damaging	0.46
R7970:Zdbf2	UTSW	1	63304171	missense	possibly damaging	0.92
R8076:Zdbf2	UTSW	1	63306101	missense	possibly damaging	0.92
R8152:Zdbf2	UTSW	1	63306413	missense	possibly damaging	0.92
R8195:Zdbf2	UTSW	1	63304066	missense	possibly damaging	0.83
R8272:Zdbf2	UTSW	1	63305983	missense	probably benign
R8306:Zdbf2	UTSW	1	63304075	missense	possibly damaging	0.66
R8309:Zdbf2	UTSW	1	63306591	missense	possibly damaging	0.82
R8323:Zdbf2	UTSW	1	63302914	missense	possibly damaging	0.46
R8400:Zdbf2	UTSW	1	63304976	missense	possibly damaging	0.92
R8443:Zdbf2	UTSW	1	63306007	missense	possibly damaging	0.83
R8460:Zdbf2	UTSW	1	63309570	small deletion	probably benign
R8528:Zdbf2	UTSW	1	63303386	missense	possibly damaging	0.82
R8812:Zdbf2	UTSW	1	63308113	missense	probably benign	0.00
R8962:Zdbf2	UTSW	1	63308003	missense	probably benign	0.00
R9061:Zdbf2	UTSW	1	63307137	missense
R9072:Zdbf2	UTSW	1	63305764	missense	possibly damaging	0.83
R9232:Zdbf2	UTSW	1	63308009	missense	possibly damaging	0.66
R9257:Zdbf2	UTSW	1	63306241	missense	probably damaging	1.00
R9411:Zdbf2	UTSW	1	63304129	missense	probably damaging	0.97
R9470:Zdbf2	UTSW	1	63305625	missense	possibly damaging	0.82
R9606:Zdbf2	UTSW	1	63303377	missense	possibly damaging	0.92
R9621:Zdbf2	UTSW	1	63303476	missense	possibly damaging	0.66
RF021:Zdbf2	UTSW	1	63302652	missense	possibly damaging	0.82
X0018:Zdbf2	UTSW	1	63305351	missense	possibly damaging	0.92
X0027:Zdbf2	UTSW	1	63308007	nonsense	probably null
X0057:Zdbf2	UTSW	1	63305390	missense	possibly damaging	0.66
X0063:Zdbf2	UTSW	1	63305537	missense	probably benign	0.04
Z1176:Zdbf2	UTSW	1	63304245	missense	possibly damaging	0.83
Z1177:Zdbf2	UTSW	1	63304086	frame shift	probably null
Z1177:Zdbf2	UTSW	1	63309203	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GCTCTCAACCAACTTTCAAGTTTG -3'
(R):5'- TCAAGTTGATCCATTGCAGAACG -3'

Sequencing Primer
(F):5'- GATGTTTTTCCTCGGACAATGAC -3'
(R):5'- TTGATCCATTGCAGAACGAAAAG -3'

Posted On

2016-10-05